ARTICLES een ing photolithography with Ni metal contacts on silicon substrates with buffer solution containing 2 AM KCl with pH 7.4. Multiplexing experiments 00-nm-thick oxide layer. The metal contacts were pass were carried out by interfacing up to three independent lock-in amplifiers to on of 50-nm thick Si3N4 coating. The spacing between source-drain different nanowire elements within the sensor arrays; the output was electrodes(active sensor area) was 2 um in all experiments. Protein samples recorded simultaneously as a function of time by computer through analog were delivered to the nanowire device arrays using fluidic channels formed by a to-digital converter. flexible poly( dimethylsiloxane)polymer channel sealed to the device chip, We note that frequency-dependent measurements show that for a 126-times d samples were delivered through inlet/outlet connection in the polymer. increase in detection frequency( from the value used in our studies )the bindir reases-5x; that is, it takes substantially longer. This behavior suggests Nanowire surface modification. A two-step procedure was used to covalently ctrokinetic effects, which have been reported to lead to enhancements in link antibody receptors and oligonucleotides to the surfaces of the silico al concentration of a variety of biological species, contribute to and nanowire devices. First, the devices were reacted with a 1% ethanol solution of 3.(trimethoxysilyl)propyl aldehyde (United Chemical Technologies)for G 30 min, washed with ethanol ed at 120 C for 15 min. MAb AFM measurements. The increase in the thickness of silicon na as a a receptors, anti-PSA(Abl, clone ER-PR8, NeoMarkers), anti-ACT-PSA(Abll, function of silane modification times measured by atomic force mic clone PSAl with 59% cross-reactivity to ACT-PSA, Abcam), anti-CEA antibody scopy (AFM, Nanoscope Illa, Digital Instruments) on a lithographically (done COL-l, Neomarkers) and anti-mucin-l(clone B413, Abcam)were marked Au surface, to localize and measure the same nanowires each time. coupled to the aldehyde-terminated nanowire surfaces by reaction of 10-100 Hg/ml antibody in a pH 8.4, 10 mM phosphate buffer solution Note: Supplementary information is available on the Nature Biotechnology website. o containing 4 mM sodium cyanoborohydride for a period of 2-3 h Unreacted ACKNOWLEDGMENTS aldehyde surface groups were subsequently passivated by reaction with ethanolamine, in the presence of 4 mM cyanoborohydride, under similar support of this work by the Defense Advanced Research Projects Agency and g conditions for a period of 1-2 h. Device arrays for multiplexed experiments the National Cancer Institute. were made in the same way except that distinct antibody solutions(1% vol/vol carol)were spotted on different regions of the array. The antibody surface COMPETING INTERESTS STATEMENT ensity versus reaction time was quantified by reacting Au-labeled IgG The authors ntibodies(5 nm Au-nanoparticles, Ted Pella laboratories) with aldehyde- aminated nanowires, and then imaging the modified nanowire by transmis- onlineathttp://www.nature.com/naturebiotechnology/ sion electron andpermissionsinformationisavailableonlineathttp://npg.naturecom o Protein samples. PSA, PSA-ACT, CEA and mucin-l were purchased from Sander. C. Genomic medicine and the future of health care. Science 287. 1977-1978 purification and diluted in the assay buffer(1 uM phosphate buffer solution ontaining 2 HM KCl with pH 7.4) prior to sensing measurements. R. ef al. The case for early detection. Nat. Rev. Cancer 3. 243-25 a Serum samples. Donkey serum(pooled preparation obtained from normal 3. Srinivas, PR, Kramer, B s.& Srivastava, S Trends donor herd, total protein 59 mg/ml), and human serum( from clotted human 4. Wulfkuhle. JD c.2,698-704 LA. petric male whole blood, 40-90 mg/ml total protein) were purchased from Sigma roteomic applications for the early desalted using a microcentrifuge filter(Centricon YM-3, 3,000 MwCO, 5. Brawer, M.K. ecific Antigen ekker, New York, 2001). o injection into the detection system. PSA was added to donkey serum before the 2 A sky,D Millipore)and diluted back to the original protein concentration with the 6. Sidr molecular markers of cancer. Nat Rev. Cancer 2. 210-219 assay buffer solution(I uM phosphate buffer, 2 uM KCl, pH 7.4)before Abeloff, M D, Armitage, J.O., Lichter, A.S.&Niederbuber, J.E. Clinical Oncology desalting step for data presented in the paper; however, similar results were also 8. Ward, A M, Catto, JWF&Hamdy, gen: biology, biochemistry btained from samples in which PSa was added after desalting. and available commercial assays. Ann Clin Biochem. 38, 633-651(20 Cell samples and nanowire modification for telomerase experiments. All cell 10.Chou, S.F. Hsu, W.L. Hwang. J.M.& chen, C.Y. Development of an immunosensor for extracts from frozen cell pellets were prepared using CHAPS lysis buffer Centricon International, 100 Al 1x CHAPs buffer, 10 mM Tris-HCl H7.5, 1 mM MgCl, I mM EGTA, 0.1 mM benzamidine, 0.5% CHAPs 11. Alivisatos, P. The use of nanocrystals in biological detection. Nat. Biotechnol. 22, (3-1(3-cholamidopropyl)dimethylammoniol propanesulfonic acid), 5 mM 12.Gao, X Cui, Y, Levenson, R. M. Chung, L W.K. Nie, S. In vivo targeting and imaging sed and diluted in telomerase assay buffer o m hePes buffer. l.5 mm Ko13地9mmmm O HM MgCl and 10 AM EGTA, PH 7.4). Normal human fibroblast cells te-specific antigen with nanoparticle label technology. Clin. Chem. 47, (ATCC), Hela cells(Chemicon International), AZTTP (azido deoxythymidine 26 269-1278(2001). dgtp dUTp and 14. Nam, J.M., Thaxton, C.S.& Mirkin, C.A. Nanoparticle-based bio bar codes for the ldehyde functionalized silicon nanowires were modified with the amino. 15. Wr senst ave detection of proteins. Science 301, 1884-1886(2003) modified oligonucleotide 5-H,N-(CH,)6. TTTTTTAATCCGTCGAGCAG Biotechn.19,856860(2001) GTT-3'(Sigma-Genosys)in 100 mM phosphate buffer, pH 8.4, and 5 mM 16. Chen, R.J. et al. Noncovalent functionalization of carbon nanotubes for highly electronic biosensors. Proc. Natl. Acad. ScL. USA 100. 4984-4989 NaCNBH3 for 2 h. The sensor array was washed using the microfluidic channel with 100 mM phosphate buffer PH 8.4, and then the telomerase assay buffer 17. Chen, R. et al. An investigation of the me (10 HM Hepes buffer, 1.5 mM KCL, 100 HM MgCl and 10 HM EGTA, pH 7.4) sorption on carbon nanotube devices. J. Am. Chem. Soc. 126, 1563-1568 Electrical measurements. Electrical measurements were made using lock- in 18. Cui, Y, Wei, Q.Q., Park, H.K. Lieber, C M. Nanowire t detection with a modulation frequency of 79 Hz The modulation ampli- (200 tude was 30 mV and the dc source-drain potential was set at zero to avoid 19. Ferrari, M Cancer nanotechnology: opportunities and challenges. Nat Rev. Cancer 5 ectrochemical reactions. Conductance- versus-time data was recorded 161-171(200 whereas buffer solutions, or different protein solutions, were flowed through 20. MacBeath, G& Schreiber, SL Printing proteins as microarays for high-throughput he microfluidic channel. Protein sensing experiments were performed in the 21. Arenkov, P. et al. Protein microchips: use for immunoassay and enzymatic reactions microfluidic channel under a flow rate of 0. 15 ml/h in 1 uM phosphate Ana. BAochem.278,123-131(2000) 1300 VOLUME 23 NUMBER 10 OCTOBER 2005 NATURE BIOTECHNOLOGYusing photolithography with Ni metal contacts on silicon substrates with 600-nm-thick oxide layer. The metal contacts were passivated by subsequent deposition of B50-nm thick Si3N4 coating. The spacing between source-drain electrodes (active sensor area) was 2 mm in all experiments. Protein samples were delivered to the nanowire device arrays using fluidic channels formed by a flexible poly(dimethylsiloxane) polymer channel sealed to the device chip18, and samples were delivered through inlet/outlet connection in the polymer. Nanowire surface modification. A two-step procedure was used to covalently link antibody receptors and oligonucleotides to the surfaces of the silicon￾nanowire devices. First, the devices were reacted with a 1% ethanol solution of 3-(trimethoxysilyl)propyl aldehyde (United Chemical Technologies) for B30 min, washed with ethanol and heated at 120 1C for 15 min. MAb receptors, anti-PSA (AbI, clone ER-PR8, NeoMarkers), anti-ACT-PSA (AbII, clone PSA1 with 59% cross-reactivity to ACT-PSA, Abcam), anti-CEA antibody (clone COL-1, Neomarkers) and anti-mucin-1 (clone B413, Abcam) were coupled to the aldehyde-terminated nanowire surfaces by reaction of 10–100 mg/ml antibody in a pH 8.4, 10 mM phosphate buffer solution containing 4 mM sodium cyanoborohydride for a period of 2–3 h. Unreacted aldehyde surface groups were subsequently passivated by reaction with ethanolamine, in the presence of 4 mM cyanoborohydride, under similar conditions for a period of 1–2 h. Device arrays for multiplexed experiments were made in the same way except that distinct antibody solutions (1% vol/vol glycerol) were spotted on different regions of the array. The antibody surface density versus reaction time was quantified by reacting Au-labeled IgG antibodies (5 nm Au-nanoparticles, Ted Pella laboratories) with aldehyde￾terminated nanowires, and then imaging the modified nanowire by transmis￾sion electron microscopy. Protein samples. PSA, PSA-ACT, CEA and mucin-1 were purchased from Calbiochem. All protein samples were used as received without further purification and diluted in the assay buffer (1 mM phosphate buffer solution containing 2 mM KCl with pH 7.4) prior to sensing measurements. Serum samples. Donkey serum (pooled preparation obtained from normal donor herd, total protein 59 mg/ml), and human serum (from clotted human male whole blood, 40–90 mg/ml total protein) were purchased from Sigma, desalted using a microcentrifuge filter (Centricon YM-3, 3,000 MWCO, Millipore) and diluted back to the original protein concentration with the assay buffer solution (1 mM phosphate buffer, 2 mM KCl, pH 7.4) before injection into the detection system. PSA was added to donkey serum before the desalting step for data presented in the paper; however, similar results were also obtained from samples in which PSA was added after desalting. Cell samples and nanowire modification for telomerase experiments. All cell extracts from frozen cell pellets were prepared using CHAPS lysis buffer (Centricon International, 100 ml 1
CHAPS buffer, 10 mM Tris-HCl, pH 7.5, 1 mM MgCl2, 1 mM EGTA, 0.1 mM benzamidine, 0.5% CHAPS (3-[(3-cholamidopropyl)dimethylammonio] propanesulfonic acid), 5 mM a-mercaptoethanol and 10% glycerol) fractionated and stored at 80 1C until used and diluted in telomerase assay buffer (10 mM HEPES buffer, 1.5 mM KCl, 100 mM MgCl2 and 10 mM EGTA, pH 7.4). Normal human fibroblast cells (ATCC), HeLa cells (Chemicon International), AZTTP (azido deoxythymidine triphosphate, Sigma-Aldrich), and dATP, dGTP, dUTP and dCTP (Sigma). Aldehyde functionalized silicon nanowires were modified with the amino￾modified oligonucleotide 5¢-H2N-(CH2)6- TTTTTTAATCCGTCGAGCAGA GTT-3¢ (Sigma-Genosys) in 100 mM phosphate buffer, pH 8.4, and 5 mM NaCNBH3 for 2 h. The sensor array was washed using the microfluidic channel with 100 mM phosphate buffer pH 8.4, and then the telomerase assay buffer (10 mM Hepes buffer, 1.5 mM KCl, 100 mM MgCl2 and 10 mM EGTA, pH 7.4). Electrical measurements. Electrical measurements were made using lock-in detection with a modulation frequency of 79 Hz. The modulation ampli￾tude was 30 mV and the dc source-drain potential was set at zero to avoid electrochemical reactions. Conductance-versus-time data was recorded whereas buffer solutions, or different protein solutions, were flowed through the microfluidic channel. Protein sensing experiments were performed in the microfluidic channel under a flow rate of 0.15 ml/h in 1 mM phosphate buffer solution containing 2 mM KCl with pH 7.4. Multiplexing experiments were carried out by interfacing up to three independent lock-in amplifiers to different nanowire elements within the sensor arrays; the output was recorded simultaneously as a function of time by computer through analog￾to-digital converter. We note that frequency-dependent measurements show that for a 12.6-times increase in detection frequency (from the value used in our studies) the binding time increases B5
; that is, it takes substantially longer. This behavior suggests that electrokinetic effects, which have been reported to lead to enhancements in the local concentration of a variety of biological species49, contribute to and enhance the observed binding kinetics in our measurements. AFM measurements. The increase in the thickness of silicon nanowires as a function of silane modification times was measured by atomic force micro￾scopy (AFM, Nanoscope IIIa, Digital Instruments) on a lithographically marked Au surface, to localize and measure the same nanowires each time. Note: Supplementary information is available on the Nature Biotechnology website. ACKNOWLEDGMENTS We thank M. Shuman (UCSF) for helpful discussion. C.M.L. acknowledges support of this work by the Defense Advanced Research Projects Agency and the National Cancer Institute. COMPETING INTERESTS STATEMENT The authors declare that they have no competing financial interests. Published online at http://www.nature.com/naturebiotechnology/ Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/ 1. Sander, C. Genomic medicine and the future of health care. Science 287, 1977–1978 (2000). 2. Etzioni, R. et al. The case for early detection. Nat. Rev. Cancer 3, 243–252 (2003). 3. Srinivas, P.R., Kramer, B.S. & Srivastava, S. Trends in biomarker research for cancer detection. Lancet Oncol. 2, 698–704 (2001). 4. Wulfkuhle, J.D., Liotta, L.A. & Petricoin, E.F. Proteomic applications for the early detection of cancer. Nat. Rev. Cancer 3, 267–275 (2003). 5. Brawer, M.K. Prostate Specific Antigen (Marcel Dekker, New York, 2001). 6. Sidransky, D. Emerging molecular markers of cancer. Nat. Rev. Cancer 2, 210–219 (2002). 7. Abeloff, M.D., Armitage, J.O., Lichter, A.S. & Niederbuber, J.E. Clinical Oncology (Churchill Livingstone, New York, 2000). 8. Ward, A.M., Catto, J.W.F. & Hamdy, F.C. Prostate specific antigen: biology, biochemistry and available commercial assays. Ann. Clin. Biochem. 38, 633–651 (2001). 9. Campagnolo, C. et al. Real-Time, label-free monitoring of tumor antigen and serum antibody interactions. J. Biochem. Biophys. Methods 61, 283–298 (2004). 10. Chou, S.F., Hsu, W.L., Hwang, J.M. & Chen, C.Y. Development of an immunosensor for human ferritin, a nonspecific tumor marker, based on surface plasmon resonance. Biosens. Bioelectron. 19, 999–1005 (2004). 11. Alivisatos, P. The use of nanocrystals in biological detection. Nat. Biotechnol. 22, 47–52 (2004). 12. Gao, X., Cui, Y., Levenson, R.M., Chung, L.W.K. & Nie, S. In vivo targeting and imaging with semiconductor quantum dots. Nat. Biotechnol. 22, 969–976 (2004). 13. Soukka, T. et al. Supersensitive time-resolved immunofluorometric assay of free prostate-specific antigen with nanoparticle label technology. Clin. Chem. 47, 1269–1278 (2001). 14. Nam, J.M., Thaxton, C.S. & Mirkin, C.A. Nanoparticle-based bio-bar codes for the ultrasensitive detection of proteins. Science 301, 1884–1886 (2003). 15. Wu, G. et al. Bioassay of prostate-specific antigen (PSA) using microcantilevers. Nat. Biotechnol. 19, 856–860 (2001). 16. Chen, R.J. et al. Noncovalent functionalization of carbon nanotubes for highly specific electronic biosensors. Proc. Natl. Acad. Sci. USA 100, 4984–4989 (2003). 17. Chen, R.J. et al. An investigation of the mechanisms of electronic sensing of protein adsorption on carbon nanotube devices. J. Am. Chem. Soc. 126, 1563–1568 (2004). 18. Cui, Y., Wei, Q.Q., Park, H.K. & Lieber, C.M. Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species. Science 293, 1289–1292 (2001). 19. Ferrari, M. Cancer nanotechnology: opportunities and challenges. Nat. Rev. Cancer 5, 161–171 (2005). 20. MacBeath, G. & Schreiber, S.L. Printing proteins as microarrays for high-throughput function determination. Science 289, 1760–1763 (2000). 21. Arenkov, P. et al. Protein microchips: use for immunoassay and enzymatic reactions. Anal. Biochem. 278, 123–131 (2000). 1300 VOLUME 23 NUMBER 10 OCTOBER 2005 NATURE BIOTECHNOLOGY ARTICLES © 2005 Nature Publishing Group http://www.nature.com/naturebiotechnology