ww.nature.com/scientificreports/ ontrol Women with a Histo of Breast Cancer(B A脉 average(range) average+SD(ang)256±81(195t31)243±46(206如31- 2(33.3% 1(16.7%) 1(16.7%) 1(16.7%) Estrogen Receptor(ER) 3(500% Progesterone Receptor(PR n(%) 1(167%) 3(500% Human Epidermal Growth Factor Receptor n(%) 3(500%) Breast Feed n(%) 4(667%) 2(333%) (16.7%) Antibiotics in the Past Year n(%) 3(50.0%) 1(166%) (50.0%) 667%) .3%) 3(50.0%) 0(000%) Recent Breast Exposure to Mouth by n(%) 3(50.0% 3(500%) Mother had Breast Cancer n(%) 2(333% 1(16.7%) 0(00.0%) 1(16.7% Dense Breast Tissue on Mammogram n(%) 2(33.3 3%) 1(167%) Unknown control women and 6 women with a history of breast cancer whose NAE samples filtering.Demographics for6healthy quality filtering and background subtraction removing all oTUs detected in the empty control Eppendorf tube. 5'AATorate flow cell adapters and indexing barcodes. The sequence for the forward primer(F515)was TGATACGGCGACCACCGAGACGTACGTACGGTGTGCCAGCMGCCGCGGTAA3'. The sequence for the reverse primer(R806)was 5 CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXXXACGTACGT ACCGGATACHVGGGTWTCTAAT3'. The reverse primer(R806)contained a 12-nucleotide error-correcting Golay code for sample identification. The XXXXXXXXXXXX represents a unique barcode sequence, the V rep- resents either A, C, or G, Mrepresents A or C, and W represents A or T. Amplified products were concentrated and purified by solid-phase reversible immobilization and then quantified by electrophoresis using Agilent 2100 Bioanalyzer Samples meeting the post-PCR minimum concentration were loaded into MiSeq Illumina for cluster formation and then sequenced for 250 cycles using primers designed for paired-end sequencing. The paired-end reads were uploaded to the sequence read archive with the accession number SRPo71608 SCIENTIFIC REPORTS 6: 28061 DO1: 10.1038/srep28061www.nature.com/scientificreports/ Scientific Reports | 6:28061 | DOI: 10.1038/srep28061 8 incorporate flow cell adapters and indexing barcodes. The sequence for the forward primer (F515) was 5′AATGATACGGCGACCACCGAGACGTACGTACGGTGTGCCAGCMGCCGCGGTAA3′. The sequence for the reverse primer (R806) was 5′CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXXXACGTACGT ACCGGATACHVGGGTWTCTAAT3′. The reverse primer (R806) contained a 12-nucleotide error-correcting Golay code for sample identification. The XXXXXXXXXXXX represents a unique barcode sequence, the V rep￾resents either A, C, or G, M represents A or C, and W represents A or T49. Amplified products were concentrated and purified by solid-phase reversible immobilization and then quantified by electrophoresis using Agilent 2100 Bioanalyzer. Samples meeting the post-PCR minimum concentration were loaded into MiSeq Illumina for cluster formation and then sequenced for 250 cycles using primers designed for paired-end sequencing9 . The paired-end reads were uploaded to the sequence read archive with the accession number SRP071608. Healthy Control Women (HC) Women with a History of Breast Cancer (BC) Age average (range) 52 (41 to 64) 58 (52 to 66) Caucasian n (%) 6 (100%) 6 (100%) BMI average±SD (range) 25.6±8.1 (19.5 to 35.1) 24.3±4.6 (20.6 to 31.3) Menopausal status n (%) Pre-menopausal 2 (33.3%) 1 (16.7%) Peri-menopausal 1 (16.7%) 1 (16.7%) Post-menopausal 3 (50.0%) 4 (66.6%) Estrogen Receptor (ER) n (%) Positive NA 3 (50.0%) Negative NA 3 (50.0%) Progesterone Receptor (PR) n (%) Positive NA 1 (16.7%) Negative NA 2 (33.3%) Unknown NA 3 (50.0%) Human Epidermal Growth Factor Receptor 2 (HER2) n (%) Positive NA 3 (50.0%) Negative NA 3 (50.0%) Breast Feed n (%) Yes 2 (33.3%) 3 (50.0%) No 4 (66.7%) 2 (33.3%) Unknown 0 (00.0%) 1 (16.7%) Antibiotics in the Past Year n (%) Yes 3 (50.0%) 1 (16.6%) No 3 (50.0%) 4 (66.7%) Unknown 0 (00.0%) 1 (16.7%) Hormone therapy/Oral contraceptive n (%) Yes 3 (50.0%) 2 (33.3%) No 3 (50.0%) 3 (50.0%) Unknown 0 (00.0%) 1 (16.7%) Recent Breast Exposure to Mouth by Breast-feeding/Sex n (%) Yes 3 (50.0%) 3 (50.0%) No 3 (50.0%) 2 (33.3%) Unknown 0 (00.0%) 1 (16.7%) Mother had Breast Cancer n (%) Yes 2 (33.3%) 1 (16.7%) No 4 (66.7%) 4 (66.7%) Unknown 0 (00.0%) 1 (16.7%) Dense Breast Tissue on Mammogram n (%) Yes 4 (66.7%) 3 (50.0%) No 2 (33.3%) 1 (16.7%) Unknown 0 (00.0%) 2 (33.3%) Table 2. Clinical information for women whose NAF samples passed quality filtering. Demographics for 6 healthy control women and 6 women with a history of breast cancer whose NAF samples had sufficient reads remaining after quality filtering and background subtraction removing all OTUs detected in the empty control Eppendorf tube