ARTICLES NATUREIVol 437 27 October 2005 34876.000234,879000234,882000234,885000 SNP position Mamala GTC TCAACTGTGTGAGCGAAGGGCCCCCAT GTTACACTCGGCGGTGGGAGCTTAGGAACCCCATGC GTCACACTCGGCGGTGGGAGCTTAGGAACCCCATGC TCCACGCGAGACTACTTAGTTTTCAAGCCT TCACGG CTACTTAGGTTTCAAGCCTTGTCGG TCCACGCGAGACTACTTAGGT TTCAAGCGTTGTCGG ○oooo③ Figure 7 I Genealogical relationships among haplotypes and r values in a binary representation of the same data, with coloured circles at SNP region without obligate recombination events. The region of chromosome positions where a haplotype has the less common allele at that 2(234,876,004-234884481 bp; NCBI build34) within ENr131.2q37 of SNPs all captured by a single tag SNP (with r-20.8)using ontains 36 SNPs, with zero obligate recombination events in the CEU tagging algorithm 4 have the same colour. Seven tag SNPs cor samples. The left part of the plot shows the seven different haplotypes to the seven different colours capture all the SNPs in this region. observed over this region(alleles are indicated only at SNPs), with their respective counts in the data. Underneath each of these haplotypes for the data in this region. values", or another based on the four gamete test), most of the unique haplotypes with frequency more than 0.05 across the 269 Fence falls into long segments of strong LD that contain many individuals in the phased data, and compared them to the fine-scale Ps and yet display limited haplotype diversity (Table 5) recombination map. Figure 10 shows a region of chromosome 19 Specifically, addressing concerns that blocks might be an artefact over which many such haplotypes break at identified recombination of low marker density, in these nearly complete data most of the hotspots, but others continue. Thus, the tendency towards co sequence falls into blocks of four or more SNPs(67% in YRI to 87% localization of recombination sites does not imply that all haplotypes in CEU) and the average sizes of such blocks are similar to initial break at each recombination site. estimates". Although the average block spans many SNPs(30-70), Some regions display remarkably extended haplotype structure he average number of common haplotypes in each block ranged based on a lack of recombination( Supplementary Fig. 8a, b). Most only from 4.0(CHB+ JPT) to 5.6(YRI), with nearly all haplotypes striking, if unsurprising, are centromeric regions, which lack recom in each block matching one of these few common haplotypes. These bination: haplotypes defined by more than 100 SNPs span several results confirm the generality of inferences drawn from disease- megabases across the centromeres. The X chromosome has multiple mapping studies" and genomic surveys with smaller sample sizes regions with very extensive haplotypes, whereas other chromosomes and less complete data typically have a few such domains. ong-range haplotypes and local patterns of recombination. Most global measures of LD become more consistent when Although haplotypes often break at recombination hotspots(and measured in genetic rather than physical distance. For example, block boundaries), this tendency is not invariant. We identified all when plotted against physical distance, the extent of pairwise LI Table 5 I Haplotype blocks in ENCODE regions, according to two methods CHB+JPT Average number of SNPs per block 30.3 544 Average length per block (kb) Fraction of genome spanned by blocks(% Average number of haplotypes (MAF 2 0.05) per block 01 Fraction of chromosomes due to haplotypes with MAF 20.05(%) Method based on the four gamete tests Average number of SNPs per block 24.3 Average length per block(kb) Average number of haplotypes (MAF 2 0.05) per block 5.12 3.63 Fraction of chromosomes due to haplotypes with MAF 2 0.05(%) 2005 Nature Publishing Group© 2005 Nature Publishing Group values30, or another based on the four gamete test51), most of the sequence falls into long segments of strong LD that contain many SNPs and yet display limited haplotype diversity (Table 5). Specifically, addressing concerns that blocks might be an artefact of low marker density52, in these nearly complete data most of the sequence falls into blocks of four or more SNPs (67% in YRI to 87% in CEU) and the average sizes of such blocks are similar to initial estimates30. Although the average block spans many SNPs (30–70), the average number of common haplotypes in each block ranged only from 4.0 (CHB þ JPT) to 5.6 (YRI), with nearly all haplotypes in each block matching one of these few common haplotypes. These results confirm the generality of inferences drawn from disease￾mapping studies27 and genomic surveys with smaller sample sizes29 and less complete data30. Long-range haplotypes and local patterns of recombination. Although haplotypes often break at recombination hotspots (and block boundaries), this tendency is not invariant. We identified all unique haplotypes with frequency more than 0.05 across the 269 individuals in the phased data, and compared them to the fine-scale recombination map. Figure 10 shows a region of chromosome 19 over which many such haplotypes break at identified recombination hotspots, but others continue. Thus, the tendency towards co￾localization of recombination sites does not imply that all haplotypes break at each recombination site. Some regions display remarkably extended haplotype structure based on a lack of recombination (Supplementary Fig. 8a, b). Most striking, if unsurprising, are centromeric regions, which lack recom￾bination: haplotypes defined by more than 100 SNPs span several megabases across the centromeres. The X chromosome has multiple regions with very extensive haplotypes, whereas other chromosomes typically have a few such domains. Most global measures of LD become more consistent when measured in genetic rather than physical distance. For example, when plotted against physical distance, the extent of pairwise LD Table 5 | Haplotype blocks in ENCODE regions, according to two methods Parameter YRI CEU CHB þ JPT Method based on a composite of local D’ values30 Average number of SNPs per block 30.3 70.1 54.4 Average length per block (kb) 7.3 16.3 13.2 Fraction of genome spanned by blocks (%) 67 87 81 Average number of haplotypes (MAF $ 0.05) per block 5.57 4.66 4.01 Fraction of chromosomes due to haplotypes with MAF $ 0.05 (%) 94 93 95 Method based on the four gamete test51 Average number of SNPs per block 19.9 24.3 24.3 Average length per block (kb) 4.8 5.9 5.9 Fraction of genome spanned by blocks (%) 86 84 84 Average number of haplotypes (MAF $ 0.05) per block 5.12 3.63 3.63 Fraction of chromosomes due to haplotypes with MAF $ 0.05 (%) 91 95 95 Figure 7 | Genealogical relationships among haplotypes and r 2 values in a region without obligate recombination events. The region of chromosome 2 (234,876,004–234,884,481 bp; NCBI build 34) within ENr131.2q37 contains 36 SNPs, with zero obligate recombination events in the CEU samples. The left part of the plot shows the seven different haplotypes observed over this region (alleles are indicated only at SNPs), with their respective counts in the data. Underneath each of these haplotypes is a binary representation of the same data, with coloured circles at SNP positions where a haplotype has the less common allele at that site. Groups of SNPs all captured by a single tag SNP (with r 2 $ 0.8) using a pairwise tagging algorithm53,54 have the same colour. Seven tag SNPs corresponding to the seven different colours capture all the SNPs in this region. On the right these SNPs are mapped to the genealogical tree relating the seven haplotypes for the data in this region. ARTICLES NATURE|Vol 437|27 October 2005 1306