Function: For the position of ribosome correctly with respect to the initiation codon E coli trp A 5)AGC CGAGGGGAAAUCUGAU GGAACGCUA C(3) E coli araB U UUGGA UGGAGUGAAACGAUGGCGAUUGCA E coli lacI CAA UUCAGGGUGGUGAAUGUGAAACCAGUA oX174 phage A protein AA UCUUGGAGGCUUUUUUAUGGUUCGUUCU a phage cro AU GUACUAAGGAGGUUGUAUGGAACAACGC Shine- Dalgarno sequence; Initiation codon pairs with 16srRNA pairs with fMet-tRNAIMet G 3’ End of Prokaryotic mrNA 16S rRNA with consensus UCCUCCA Shine-Dalgarno (5)GA UUCCUAGGAGGUUUGACCUAUGCGAGCUU U UA G U(3) sequence (b)AUG Function: For the position of ribosome correctly with respect to the initiation codon