weight were measured. In the antibiotic treated mouse cohort 18 mice were studied [two independent experiments of 9M in the treatment group and 9M in the control group].Mice were of the same size and gender distribution in each replicate. In the antibiotic treated study the control mouse group was E. coli transformed with pET28c: hm-NAS, which contains an N-acyl serinol synthase gene containing a single point mutation that rendered the enzyme non-functional(E94A)(see method section below). The animal experiments were not randomized and the investigators were not blinded to the allocation during experiments and outcome assessment. No statistical methods were used to predetermine sample size. All mice which completed the experiments were analyzed Generation of active site pET28c: hm-NAS N-acyl serinol synthase mutant Conserved active site residues in bacterial NASs were identified in previous biochemical and X-ray crystalography studies42 To create a catalytically inactive N-acyl serinol synthase we changed a key glutamic acid residue(Glug1)to alanine. The point mutation was created by PCR using pET28c hm-NAS N-acyl serinol synthase vector as template and the following primers F-gTTCTGTGCGATACGTCTCC and R-GCCTTTCACAGGCAGATATTC The position of point mutation is underlined in the F primer. The resulting PCR reaction was digested with Dpnl to remove any remaining methy lated vector. The PCr product was then phosphorylated, column purified and blunt end ligated(End-It, Epicentre). The vector was transformed into EC100: DE3 cells and the point mutation was confirmed by Sanger equencing. When transformed into E coll, the resultant E94A mutant construct did not confer the production of any detectable N-acyl serinols. Cultures were grown under the same conditions as the original N-acyl serinol synthase producing clone(Extended Data Fig 8) Oral glucose tolerance test One week post colonization mice were fasted overnight(16 hours)and then administered a 2 g/kg OGTT(40% glucose solution). Blood glucose was measured by tail bleed (Breeze 2 Bayer)at time 0 prior to the glucose gavage, then 15, 30, 60, 90 and 120 minutes post gavage. After one week the IPTG was removed from the mouse drinking water and mice oral glucose tolerance test was repeated. Blood glucose levels at each time point during the OGTT tests were compared between groups using a Students T-test with significance threshold of p <0.05 Insulin and glp-1 measurement Mice were given an OgTT as previously described. At 15 minutes blood was collected by submandibular bleed and immediately mixed with 10 uL of 0.5M EDTA and 5 uL of DPPIV inhibitor(Millipore, DPP4-010)per 500 uL of blood. Treated blood was spun at 2, 000 x g for 15 minutes at 4C. Plasma was collected and immediately placed at -80C Insulin was measured using the mesoscale discovery active glp-1 V2 kit. samples were analyzed for in in triplicate and GLP-1 in duplicate. Insulin was measured from experiment(N=6 mice in each group). GLP-1 was measured from mice in two independent Nature. Author manuscript; available in PMC 2018 February 28weight were measured. In the antibiotic treated mouse cohort 18 mice were studied [two independent experiments of 9M in the treatment group and 9M in the control group]. Mice were of the same size and gender distribution in each replicate. In the antibiotic treated study the control mouse group was E. coli transformed with pET28c:hm-NAS, which contains an N-acyl serinol synthase gene containing a single point mutation that rendered the enzyme non-functional (E94A) (see method section below). The animal experiments were not randomized and the investigators were not blinded to the allocation during experiments and outcome assessment. No statistical methods were used to predetermine sample size. All mice which completed the experiments were analyzed. Generation of active site pET28c:hm-NAS N-acyl serinol synthase mutant Conserved active site residues in bacterial NASs were identified in previous biochemical and X-ray crystalography studies.42 To create a catalytically inactive N-acyl serinol synthase we changed a key glutamic acid residue (Glu91) to alanine. The point mutation was created by PCR using pET28c:hm-NAS N-acyl serinol synthase vector as template and the following primers F – GTTCTGTGCGATACGTCTCC and R – GCCTTTCACAGGCAGATATTC. The position of point mutation is underlined in the F primer. The resulting PCR reaction was digested with DpnI to remove any remaining methylated vector. The PCR product was then phosphorylated, column purified and blunt end ligated (End-It, Epicentre). The vector was transformed into EC100:DE3 cells and the point mutation was confirmed by Sanger sequencing. When transformed into E. coli, the resultant E94A mutant construct did not confer the production of any detectable N-acyl serinols. Cultures were grown under the same conditions as the original N-acyl serinol synthase producing clone (Extended Data Fig 8). Oral glucose tolerance test One week post colonization mice were fasted overnight (16 hours) and then administered a 2 g/kg OGTT (40% glucose solution). Blood glucose was measured by tail bleed (Breeze 2 Bayer) at time 0 prior to the glucose gavage, then 15, 30, 60, 90 and 120 minutes post gavage. After one week the IPTG was removed from the mouse drinking water and mice were allowed to equilibrate for an additional 2 weeks.32 Three weeks post colonization the oral glucose tolerance test was repeated. Blood glucose levels at each time point during the OGTT tests were compared between groups using a Students T-test with significance threshold of p < 0.05. Insulin and GLP-1 measurement Mice were given an OGTT as previously described. At 15 minutes blood was collected by submandibular bleed and immediately mixed with 10 µL of 0.5M EDTA and 5 µL of DPPIV inhibitor (Millipore, DPP4-010) per 500 µL of blood. Treated blood was spun at 2,000 × g for 15 minutes at 4 °C. Plasma was collected and immediately placed at −80 °C. Insulin was measured using the Crystal Chem Ultra Sensitive Mouse ELISA kit and active GLP-1 was measured using the Mesoscale Discovery Active GLP-1 V2 kit. Samples were analyzed for insulin in triplicate and GLP-1 in duplicate. Insulin was measured from mice in one experiment (N = 6 mice in each group). GLP-1 was measured from mice in two independent Cohen et al. Page 13 Nature. Author manuscript; available in PMC 2018 February 28. Author Manuscript Author Manuscript Author Manuscript Author Manuscript