2 Fungal immunomodulatory proteins THE CHARACTER OF GENE,PROTEIN FIGURE 1.The blast result of FIPs coding sequences. AND SOURCE OF FIPs 50 The Character of Gene and Protein fip-glu (1) fip-gte (1) The gene encoding FIPs: FIP is a small protein with immune fip-gei (1) regulating activity.The coding region of FIPs fip-gja (1) gene is about 330-350 bp.Till now,six fip-gmi (1) isoforms of FIPs gene have been identified fip-fve (1) from Ganoderma lucidum (Murasugi et al., Consensus (1)ATGTOCGACACTGCCTTGATCTTCAGGOTOGOCTGGGACGTGAAGAAGCT 1991),G.tsugae (Lin et al.,1997), 51 100 Flammulina velutipes (Ko et al.,1997),G. sinensis(Zhou et al.,2009),G.japoncium,and fip-glu (51) G.microsporum (Tsai et al.,2007),respectively. fip-gta (51) CTC6 These genes are named as LZ-8(FIP-glu以，FlP fip-gei (51) gts,FIP-fue,FIP-gsi,FIP-gja (AY987805)and fip-gja (51) FIP-gmi,respectively.The FIPs coding sequences from Volvaria volvacea,FIP-vvo,are fip-gmi (51) E无TT obtained based on the amino acid sequence. fip-fve 51) The blasting results of the nucleotide Congengus (51) CTOGTTOGACTACACOOOGAACTGGGGOOGTGGCAACOOCAGCAGCTTCA sequences of FIPs are shown in Figure 1. 101 150 The gene encoding an fip-glu (101) immunomodulatory protein,LZ-8,from fip-gts (101) TCT G.lucidum,has two CAAT boxes and one TATA box upstream of LZ-8 gene fip-gai (101) transcription start site,and a 61 bp intron fip-gja (101) at the 5'-untranslated region (Murasugi et fip-gmi (101) al.,1991).Using homology-based cloning fip-fve (101) method,FIP genes (AY449802, AY449805,AY449804,AY449803)have Coneeneus(101) been cloned from Zi Zhi (G.sinensis),Han 151 200 Zhi (G.spp.),and Tian Zhi (G.spp.)(Liu fip-glu (151) et al.,2006).Besides,the FIP gene is fip-gte (151) cloned from black Ganoderma(G.atrum) fip-gai (151) in our laboratory recently.It also possesses high homology to LZ-8 gene in nucleotide fip-gja (151) sequence after aligning the sequences(Lin fip-gmi (151) et al.,1997).The sequencing results fip-fve (151) showed that the FIP-gts and LZ-8 genes had Coneeneue(151)CGOGTOGTOGTCTCTGG CGGGACCTTGGOGTGOGOCCCTOGTACGOGGT very similar nucleotide sequences.Our 201 250 previous studies showed that a 1072 bp DNA segment was cloned from G.sinense, fip-glu (201) including a 501 bp 5'flanking region,a fip-gt8 (201) 333 bp open read frame(ORF)and a 238 fip-gei 201) ATGECT bp 3'flanking region.And one TATA box, fip-gja (201) one CAAT box and one G box was fip-gmi (201) detected respectively in 5'flanking region. There was one intron(61 bp)in the other fip-fve (201)GACACCGTCCGGTGGGCAGACCATCAACTTOCTOCAGTACAACAAGGGGT FIP genes,which was similar to the Coneeneue(201)GG GAGCGACGGCTCGCAGAAGGTCAACTTCCTCGAGTACAACTOGGGGT sequence of 5'flanking region of LZ-8 251 300 (Zhou et al.,2009).In addition,the fip-glu (251) nucleotide sequence of FIP could be used (251) to distinguish the different Ganoderma fip-gte genus (Zhou et al.,2008). fip-gei (251)2 Fungal immunomodulatory proteins THE CHARACTER OF GENE, PROTEIN AND SOURCE OF FIPs The Character of Gene and Protein The gene encoding FIPs: FIP is a small protein with immune regulating activity. The coding region of FIPs gene is about 330-350 bp. Till now, six isoforms of FIPs gene have been identified from Ganoderma lucidum (Murasugi et al., 1991), G. tsugae (Lin et al., 1997), Flammulina velutipes (Ko et al., 1997), G. sinensis (Zhou et al., 2009), G. japoncium, and G. microsporum (Tsai et al., 2007), respectively. These genes are named as LZ-8(FIP-glu), FIP￾gts, FIP-fve, FIP-gsi, FIP-gja (AY987805) and sequences from Volvaria volvacea, FIP-vvo, are obtained based on the amino acid sequence. The blasting results of the nucleotide sequences of FIPs are shown in Figure 1. The gene encoding an immunomodulatory protein, LZ-8, from G. lucidum, has two CAAT boxes and one TATA box upstream of LZ-8 gene transcription start site, and a 61 bp intron at the 5’-untranslated region (Murasugi et al., 1991). Using homology-based cloning method, FIP genes (AY449802, AY449805, AY449804, AY449803) have been cloned from Zi Zhi (G. sinensis), Han Zhi (G. spp.), and Tian Zhi (G. spp.) (Liu et al., 2006). Besides, the FIP gene is cloned from black Ganoderma (G. atrum) in our laboratory recently. It also possesses high homology to LZ-8 gene in nucleotide sequence after aligning the sequences (Lin et al., 1997). The sequencing results showed that the FIP-gts and LZ-8 genes had very similar nucleotide sequences. Our previous studies showed that a 1072 bp DNA segment was cloned from G. sinense, including a 501 bp 5’ flanking region, a 333 bp open read frame (ORF) and a 238 bp 3’ flanking region. And one TATA box, one CAAT box and one G box was detected respectively in 5’ flanking region. There was one intron (61 bp) in the other FIP genes, which was similar to the sequence of 5’ flanking region of LZ-8 (Zhou et al., 2009). In addition, the nucleotide sequence of FIP could be used to distinguish the different Ganoderma genus (Zhou et al., 2008). FIGURE 1. The blast result of FIPs coding sequences. FIP-gmi, respectively. The FIPs coding