bound by 11.3 Functional Cll alone clustering in bound by cll polymerase phages T7 and T4 八 -50-40-3020-10+10 Figure 11 24 RNA Startpoint polymerase binds Usual toI re only in the sequence sequence at -35 at-10 presence of CIl TTGACA TATAAT which contacts the GCAACGCAAA CAAACGTGCTTGGIATACATTCATAAAGGAATCTA CGTTGCGTTTGTTTGCACGAACCATAT GTAAGTATTTCCTTAGAT region around -35 cyR mutations cvl mutations 消当 polymerase binding polymerase binding affect cll bindingFigure 11.24 RNA polymerase binds to PRE only in the presence of CII, which contacts the region around -35. 11.3 Functional clustering in phages T7 and T4