G C GIG GTC GAC T GIC CGA TIC AGTC GAC CIT DNA with ACGCCCAGCTGACGGCTAGTCAGCTGGA inverted Transcription of one strand OUGCGGGUCGACUGCCGAUCAGUCGAC CUUUU RNA UGCG UUUU G C GIC cIG Stem-loop in RNA GIC mmediately upstream from a run of uracils leads to termination CIG of transcription UIA G C A stem-loop results in termination of conscriptionA stem-loop results in termination of transcription