7.012: Introductory Biology -Fall 2004 Instructors: Professor Eric Lander, Professor Robert A Weinberg, Dr. Claudette Gardel Name 7.012 Problem set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in at the box outside by 4: 10 Wednesday, october22 Problem sets will not be accepted late Solutions will be posted on the web October 23, 2003 PLEASE NOTE Questions 1 and 2 cover material from lectures 14 and 15 and thus would be good practice for Quiz Il Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes bamHI and Bcll a)Bamhi, cleaves after the first g 5 GGATCC 3 3' CCTAGG 5 Does cleavage by BamHI result in a 5 or 3 overhang? What is the sequence of this overhang? b) bcll cleaves after the first t 5 TGATCA 3 3' 5 Does cleavage by Bcll result in a 5 or 3 overhang? What is the sequence of this overhang c) Given the dna shown below 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3/ 3/ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5 i)If this dna was cut with BamHl, how many dna fragment would you expect? Write out the sequence of these double-stranded DNA fragments 7012Fall2003Name:___________________________________ Section:_____ 7.012 Fall 2003 1 7.012 Problem Set 5 *PLEASE NOTE,: Questions 1 and 2 cover material from lectures 14 and 15 and thus would be good practice for Quiz II. Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G: 5’ GGATCC 3’ 3’ CCTAGG 5’ Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? b) BclI cleaves after the first T: 5’ TGATCA 3’ 3’ ACTAGT 5’ Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? c) Given the DNA shown below … 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in at the box outside by 4:10 Wednesday, October22. Problem sets will not be accepted late. Solutions will be posted on the web October 23, 2003. MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel