REP。RTs mosome/autosome(three to four times as many as the former) in the presence of bottleneck M88 from Africa, therefore disqualifying the utility f the latter in distinguishing the competing hypotheses(24, 30) References and notes 1. R L Cann, M. Stoneking A. C. Wilson, Nature 325, 31 A.C. wilson, Science 253, 1503(15 African Arcan+ Non-Afrlcan 3. C.B. Stringer, P. Andrew, Science 239, 1263(1988). g 1. The phylog tionships of the Y chromosome haplotypes of African and other world populations. The red branches are African-specific haplotypes. The blue branches are non-African- specific haplotypes, and the green ones are shared between Africans and non-Africans (modified 6. S A Tishkoff et al. Science 271, 1380(1996) from Underhill et al.(21)I 7. JY. Chu et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 Npopt number of populations: Nind, number of individuals. 11. V.O. Igor et al., Nature 404, 490(2000) 12. AS.Brooks, B Wood, Nature 344, 288(1990) Geographic region N M130T YAP+ 13. T Li, D A. Etler, Nature 357, 404(1992) 14. x. Z. Wu, F. E. Poirier, Human Evolution in China Central siberia 70 anthropOl25.275(1996) Okhotsk/Amur 3564 567929g072 16. C.C. Swisher et aL, Science 274, 1870(1996). Kamchatka/ Chukotka 102 Northern East Asia Northern han Chinese 459 Southern han chinese 3575 5127 entral Siberia(Tuvan, Tofala Taiwanese Aborigines ey Evenk, Buryat-1, and Buryat-2): Okhotsk/Amur Okhotsk Evenk, Ulchi/Nanai, Upriver NegidaL, hatka/ Chukotka( Koryak, Item Guinea/melanesia ortheast india Kazak-Xinjiang, and Uyghur): northern Han Chinese It was argued that the extensive genetic data would have been expected in East Asia, which supporting the Out-of-Africa hypothesis could was not observed in our data. However, this also be explained by the multiregional hypoth- observation does not necessarily preclude the ubei, Sichuan, Jiangxi Guangxi, Guangdong, and Guizhou): Taiwan(Bu esis under a version of the trellis model(23). possibility of selection sweep that could erase This model suggests that a multiregional evo- archaic Y chromosomes of modern humans in utionary paradigm is shared across the human East Asia. On the other hand, a minor contri- range by frequent gene exchanges between con- bution from a female lineage of local origin Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, tinental populations since Homo erectus came cannot be excluded either, which should b Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Nort out of Africa about 1 million years ago(23). It further studied with the use of mitochondrial Bai-1, and Bai-2): IndonesiaMalaysia [Malay CB, Malay KM, Orang is difficult to test the trellis model with markers DNA(mtDNA)markers. Because the y chro- Asli, Batak, Malay (Pakanbaru). Minangkabau, rom mitochondrial hypervariable region(D- mosome has a relatively small effective pop loop) and autosome because these markers ulation size, it is subject to stochastic process, show frequent recurrent mutations and/or re- e.g, genetic drift, which could also lead to nd Sakai]: Polynesia/Micronesia(Truk,Guam,Pa- combination(24, 25), respectively. However, extinction of archaic lineages. However, in lau, Majuro, Kribati, Pohnpei, Nauru, Kapingama this can be circumvented by the application of a our study, with 163 populations from differ- rangi, Tonga, American Somoan, and West So- large number of Y chromosome biallelic mark- ent regions of Asia, it is hard to imagine that ers, which escape recombination and have a all of the 163 populations should drift in the n-1, New Guinean-2, Bankes and Torres, Santo low mutation rate. It has been shown that all the same direction and Maewo) Y chromosome haplotypes found outside Afri- Assam abha(Assam), and Naga. The ca are younger than 35, 000 to 89,000 years and mon ancestor with the use of mitochondrial/Y numbered populations of the same ethnicity were rived from Africa(2), although this estima- chromosome and autosome/x chromosome 18. Genotyping was conducted by a polymerase chain tion is crude and depends on several assump markers, however, creates confusion. The age tions. In addition, if extensive gene flow had estimated with the use of autosome/X chromo- e engineered for MT occurred between continental populations dur- some genes ranges from 535,000 to 1, 860,000 (Bsl n)and M89(Nla In) by designing misma ing the past 1 million years but before the years(26-29), much older than those for divergence between Africans and non-Africans, mtDNA and Y chromosome. However, this (M89)and TATCTCCTCT TCTAT TGCAG/CCACAAGG- cient y chromosome haplotypes seen in Afri- the difference in the effective population sizes prerious reports 5. 9) ien ping was repeated to can populations or even much older haplotypes between Y chromosome/mtDNA and X chro- 19. M A Jobling et al, Trends Genet. 11, 449( 1995) 1152 11 MAY 2001 VOL 292 SCIENCE .sClencemag orgIt was argued that the extensive genetic data supporting the Out-of-Africa hypothesis could also be explained by the multiregional hypoth￾esis under a version of the trellis model (23). This model suggests that a multiregional evo￾lutionary paradigm is shared across the human range by frequent gene exchanges between con￾tinental populations since Homo erectus came out of Africa about 1 million years ago (23). It is difficult to test the trellis model with markers from mitochondrial hypervariable region (D￾loop) and autosome because these markers show frequent recurrent mutations and/or re￾combination (24, 25), respectively. However, this can be circumvented by the application of a large number of Y chromosome biallelic mark￾ers, which escape recombination and have a low mutation rate. It has been shown that all the Y chromosome haplotypes found outside Afri￾ca are younger than 35,000 to 89,000 years and derived from Africa (21), although this estima￾tion is crude and depends on several assump￾tions. In addition, if extensive gene flow had occurred between continental populations dur￾ing the past 1 million years but before the divergence between Africans and non-Africans, as suggested by the multiregionalists, the an￾cient Y chromosome haplotypes seen in Afri￾can populations or even much older haplotypes would have been expected in East Asia, which was not observed in our data. However, this observation does not necessarily preclude the possibility of selection sweep that could erase archaic Y chromosomes of modern humans in East Asia. On the other hand, a minor contri￾bution from a female lineage of local origin cannot be excluded either, which should be further studied with the use of mitochondrial DNA (mtDNA) markers. Because the Y chro￾mosome has a relatively small effective pop￾ulation size, it is subject to stochastic process, e.g., genetic drift, which could also lead to extinction of archaic lineages. However, in our study, with 163 populations from differ￾ent regions of Asia, it is hard to imagine that all of the 163 populations should drift in the same direction. Inconsistency of age estimations for a com￾mon ancestor with the use of mitochondrial/Y chromosome and autosome/X chromosome markers, however, creates confusion. The age estimated with the use of autosome/X chromo￾some genes ranges from 535,000 to 1,860,000 years (26–29), much older than those for mtDNA and Y chromosome. However, this difference in age estimation might only reflect the difference in the effective population sizes between Y chromosome/mtDNA and X chro￾mosome/autosome (three to four times as many as the former) in the presence of bottleneck events associated with the outbound migrations from Africa, therefore disqualifying the utility of the latter in distinguishing the competing hypotheses (24, 30). References and Notes 1. R. L. Cann, M. Stoneking, A. C. Wilson, Nature 325, 31 (1987). 2. L. Vigilant, M. Stoneking, H. Harpending, K. Hawkes, A. C. Wilson, Science 253, 1503 (1991). 3. C. B. Stringer, P. Andrew, Science 239, 1263 (1988). 4. A. M. Bowcock et al., Nature 368, 455 (1994). 5. M. F. Hammer, Nature 378, 376 (1995). 6. S. A. Tishkoff et al., Science 271, 1380 (1996). 7. J. Y. Chu et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998). 8. L. Quintana-Murci et al., Nature Genet. 23, 437 (1999). 9. B. Su et al., Am. J. Hum. Genet. 65, 1718 (1999). 10. M. Krings et al., Cell 90, 19 (1997). 11. V. O. Igor et al., Nature 404, 490 (2000). 12. A. S. Brooks, B. Wood, Nature 344, 288 (1990). 13. T. Li, D. A. Etler, Nature 357, 404 (1992). 14. X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995). 15. D. A. Etler, Annu. Rev. Anthropol. 25, 275 (1996). 16. C. C. Swisher et al., Science 274, 1870 (1996). 17. A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yeni￾sey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kam￾chatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Man￾churian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner￾Mongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bu￾nun, Atayal, Yami, Paiwan, and Ami); Southeast Asia ( Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, North￾ern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bu￾gis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia ( Truk, Guam, Pa￾lau, Majuro, Kribati, Pohnpei, Nauru, Kapingama￾rangi, Tonga, American Somoan, and West So￾moan); Papuan and New Guinean Highland (Aus￾tralian Aborigine, Nasioi-Melanesian, New Guin￾ean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently. 18. Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGAT￾GCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGG￾GGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results. 19. M. A. Jobling et al., Trends Genet. 11, 449 (1995). Table 1. Frequency distribution of the three Y chromosome polymorphisms in 163 Asian populations. NPop, number of populations; NInd, number of individuals. Geographic region NPop NInd M89T M130T YAP1 Central Asia 13 173 144 25 4 Central Siberia 5 107 70 36 1 Okhotsk/Amur 6 123 46 77 0 Kamchatka/Chukotka 4 102 73 29 0 Northern East Asia 17 578 497 42 39 Northern Han Chinese 14 4592 4296 191 105 Southern Han Chinese 13 5127 4984 97 44 Taiwanese Aborigines 5 58 58 0 0 Southeast Asia 37 620 559 37 24 Indonesia/Malaysia 25 355 333 22 0 Polynesia/Micronesia 11 113 89 23 1 New Guinea/Melanesia 7 120 105 17 0 Northeast India 6 59 57 2 0 Total 163 12,127 Fig. 1. The phylogenetic relationships of the Y chromosome haplotypes of African and other world populations. The red branches are African-specific haplotypes. The blue branches are non-African– specific haplotypes, and the green ones are shared between Africans and non-Africans [modified from Underhill et al. (21)]. R EPORTS 1152 11 MAY 2001 VOL 292 SCIENCE www.sciencemag.org