ARTICLES methylation of GR promoter. (a)Sequence map of the exon 17 GR promoter including the 17 gion b(encircled).(b, c)Methylation analysis the 17 CpG dinucleotides of the exon 17 GR promoter region from adult high-and low-LG ABN offspring (6-10 clones sequenced/animal n=4 animals/group; P<0.01).(b)Percentage of cytosine residues that were methylated (mean +s.e.m.)for the first 15 CpG dinucleotides 口 High LG-ABN (P<0.05).(c)Percentage of methylated ytosines(mean ts.e. m )for the 5'(site 16)and 3(site 17)CpG dinucleotides within the NGFl-A 1001■ LOW-LG/ABN of cross fostering the offspring of high- and low- LG-ABN mothers on cytosine methylation of the 5 and 3'CpG dinucleotides within the NGFI-A binding sequence of the exon 17 GR promot L-L: animals born to and reared by low-LG-ABN mothers H-H: animals born to and reared by high-LG-ABN mothers: H-L: animals born to 5678g10112131415 high-LG-ABN mothers and reared by low-LG-ABN mothers: L-H: animals born to low-LG-ABI mothers and reared by high-LG-ABN mothers. (e)Percentage of cytosine methylation(mean+ m)of the 5 and 3 CpG dinucleotides within 5 CpG dinucleotide 3 CpG dinucleotide 5 CpG dinucleotide 3 CpG dinucleotide the NGFl-A binding region of the exon 17 GR romoter gene in the offspring of high-or low- LGABN mothers(n= 5 animals/group; P<0.001)as a function of age. There were no differences at any postnatal age in level of ytosine methylation of the 3 CpG (site 17) L-L H-H H-L LH LL H-H H- L-H E20 P1 PB P21 P90 oLd P1 adulthood. Gene expression is controlled by the epigenome, which is sites of the exon 1, GR promoter sequence(Fig. 1b,c). A two-way comprised of chromatin structure/ and DNA methylation. We ANOVA revealed a highly significant effect of Group(F= 55.9 tested the hypothesis that maternal care alters DNA methylation of P<00001)and Region(F=27.7, P<00001), as well as a significant o the Gr exon 17 promoter, and that these changes are stably main- Group x Region interaction effect (F= 27.7,P<0.0001) tained into adulthood and associated with differences in GR expres- Importantly, the cytosine residue within the 5" CpG dinucleotide sion and HPa responses to stress (site 16) of the NGFl-A consensus sequence(Fig. Ic)is always methylated in the offspring of low-LG-ABN mothers, and rarely RESULTS methylated in the offspring of high-LG-ABN dams In contrast, the Maternal care and methylation of exon 17 promoter 3 CpG dinucleotide(site 17)remains methylated, regardless of dif- DNA methylation is a stable, epigenomic mark at CpG dinucleotides ferences in maternal care. Dissected hippocampi inevitably contain often associated with stable variations in gene transcription 8-20. Two glial cells as well as neurons. Considering the pronounced effect of kinds of changes in DNA methylation are known to affect gene maternal care on the methylation status of the 5" Cpg dinucleotide expression: regional, non-site specific DNA methylation around a of the NGFI-A response element(>90%), the effect of maternal care promoterand site-specific methylation. Hypomethylation of CpG must include neuronal as well as glial cells; both populations express dinucleotides of regulatory regions of genes is associated with active GR23,24 and NGFl-A25 genes chromatin ture and transcriptional activity.. Thus, the methylation pattern is a stable signature of the epigenomic status of a Cross-fostering reveals epigenetic marking by maternal behavior regulatory sequence. We focused on the methylation state of the exon Our findings suggest that specific sites within the exon 1, GR pro- 17 GR promoter, which is activated in the hippocampus in offspring moter are differentially methylated as a function of maternal behav- of high-LG-ABN mothers ior, but these findings are merely correlational. To directly examine To determine whether DNA methylation of specific target sites on the relation between maternal behavior and DNA methylation the gr promoter change in response to maternal care, we mapped within the exon 1, promoter, we performed an adoption study in differences in the methylation status of individual cytosines within which the biological offspring of high- or low-LG-ABN mothers the CpG dinucleotides of the exon 1, promoter from hippocampal were cross-fostered to either high-or low-LG-aBN dams within 12 h tissue from the adult offspring of high-and low-LG-ABN mothers. of birth. Cross-fostering produced a pattern of exon 1, promoter sodium bisulfite mapping. 22, with a particular interest in methylation that was associated with the rearing mother(F= 4.8, around the NGFl-A consensus sequence(Fig. la). The P<0.05; Fig. ld)and thus reversed the difference in methylation at wed significant differences in the methylation of specific specific cytosines, notably at the 5" CpG dinucleotide(site 16)of the 848 VOLUME 7 NUMBER 8 AUGUST 2004 NATURE NEUROSCIENCEsites of the exon 17 GR promoter sequence (Fig. 1b,c). A two-way ANOVA revealed a highly significant effect of Group (F = 55.9, P < 0.0001) and Region (F = 27.7, P < 0.0001), as well as a significant Group × Region interaction effect (F = 27.7, P < 0.0001). Importantly, the cytosine residue within the 5′ CpG dinucleotide (site 16) of the NGFI-A consensus sequence (Fig. 1c) is always methylated in the offspring of low-LG-ABN mothers, and rarely methylated in the offspring of high-LG-ABN dams. In contrast, the 3′ CpG dinucleotide (site 17) remains methylated, regardless of dif￾ferences in maternal care. Dissected hippocampi inevitably contain glial cells as well as neurons. Considering the pronounced effect of maternal care on the methylation status of the 5′ CpG dinucleotide of the NGFI-A response element (>90%), the effect of maternal care must include neuronal as well as glial cells; both populations express GR23,24 and NGFI-A25 genes. Cross-fostering reveals epigenetic marking by maternal behavior Our findings suggest that specific sites within the exon 17 GR pro￾moter are differentially methylated as a function of maternal behav￾ior, but these findings are merely correlational. To directly examine the relation between maternal behavior and DNA methylation within the exon 17 promoter, we performed an adoption study in which the biological offspring of high- or low-LG-ABN mothers were cross-fostered to either high- or low-LG-ABN dams within 12 h of birth9. Cross-fostering produced a pattern of exon 17 promoter methylation that was associated with the rearing mother (F = 4.8, P < 0.05; Fig. 1d) and thus reversed the difference in methylation at specific cytosines, notably at the 5′ CpG dinucleotide (site 16) of the Figure 1 Maternal care alters cytosine methylation of GR promoter. (a) Sequence map of the exon 17 GR promoter including the 17 CpG dinucleotides (bold) and the NGFI-A binding region16 (encircled). (b,c) Methylation analysis of the 17 CpG dinucleotides of the exon 17 GR promoter region from adult high- and low-LG￾ABN offspring (6–10 clones sequenced/animal; n = 4 animals/group; *P < 0.01). (b) Percentage of cytosine residues that were methylated (mean ± s.e.m.) for the first 15 CpG dinucleotides (*P < 0.05). (c) Percentage of methylated cytosines (mean ± s.e.m.) for the 5′ (site 16) and 3′ (site 17) CpG dinucleotides within the NGFI-A binding sequence (*P < 0.0001). (d) The effect of cross-fostering the offspring of high- and low￾LG-ABN mothers on cytosine methylation of the 5′ and 3′ CpG dinucleotides within the NGFI-A binding sequence of the exon 17 GR promoter gene in adult hippocampi (n = 5 animals/group). L-L: animals born to and reared by low-LG-ABN mothers; H-H: animals born to and reared by high-LG-ABN mothers; H-L: animals born to high-LG-ABN mothers and reared by low-LG-ABN mothers; L-H: animals born to low-LG-ABN mothers and reared by high-LG-ABN mothers. (e) Percentage of cytosine methylation (mean ± s.e.m.) of the 5′ and 3′ CpG dinucleotides within the NGFI-A binding region of the exon 17 GR promoter gene in the offspring of high- or low￾LG-ABN mothers (n = 5 animals/group; P < 0.001) as a function of age. There were no differences at any postnatal age in level of cytosine methylation of the 3′ CpG (site 17). ARTICLES adulthood. Gene expression is controlled by the epigenome, which is comprised of chromatin structure17 and DNA methylation18. We tested the hypothesis that maternal care alters DNA methylation of the GR exon 17 promoter, and that these changes are stably main￾tained into adulthood and associated with differences in GR expres￾sion and HPA responses to stress. RESULTS Maternal care and methylation of exon 17 promoter DNA methylation is a stable, epigenomic mark at CpG dinucleotides often associated with stable variations in gene transcription18–20. Two kinds of changes in DNA methylation are known to affect gene expression: regional, non-site specific DNA methylation around a promoter19 and site-specific methylation. Hypomethylation of CpG dinucleotides of regulatory regions of genes is associated with active chromatin structure and transcriptional activity18,20. Thus, the methylation pattern is a stable signature of the epigenomic status of a regulatory sequence. We focused on the methylation state of the exon 17 GR promoter, which is activated in the hippocampus in offspring of high-LG-ABN mothers. To determine whether DNA methylation of specific target sites on the GR promoter change in response to maternal care, we mapped differences in the methylation status of individual cytosines within the CpG dinucleotides of the exon 17 promoter from hippocampal tissue from the adult offspring of high- and low-LG-ABN mothers. We used sodium bisulfite mapping21,22, with a particular interest in the region around the NGFI-A consensus sequence (Fig. 1a). The results showed significant differences in the methylation of specific 848 VOLUME 7 | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE L-L H-H H-L L-H 0 20 40 60 80 100 C-methylation (%) L-L H-H H-L L-H 0 20 40 60 80 100 5´ CpG dinucleotide 3´ CpG dinucleotide High-LG/ABN Low-LG/ABN Age (d) E20 P1 P6 P21 P90 0 20 40 60 80 100 E20 P1 P6 P21 P90 0 20 40 60 80 100 * * * C-methylation (%) 5´ CpG dinucleotide 3´ CpG dinucleotide 1681 ccc 1741 ctctgctagtgtgacacactt1cg2cgcaactc3cgcagttgg4cggg5cg6cggaccacccctg7c 1801 ggctctgc8cggctggctgtcaccct9cgggggctctggctgc10cgaccca11cgggg12cgggct 1861 c13cgag14cggtt ccaagcct15cggagtggg16cggggg17cgggagggagcctgggagaa 11 14 15 16 17 18 19 110 111 2 5´ 3´ 1234 5 6 7 8 9 10 11 12 13 14 15 Region C-methylation (%) Low-LG/ABN High-LG-ABN 0 20 40 60 80 100 * * * * * * * 5´ 3´ CpG dinucleotide Low LG-ABN High LG-ABN * 0 20 40 60 80 100 a b c d e C-methylation (%) © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience