ARTICLES nature neuroscience Epigenetic programming by maternal behavior 8 Ian CG Weaver, 2, Nadia Cervoni, Frances A Champagne, 2, Ana C D'Alessio Shakti Sharma! Jonathan R Seckl#, Sergiy Dymov Moshe Szyf2,3& Michael J Meaney,2 Here we report that increased pup licking and grooming(LG)and arched-back nursing(ABN) by rat mothers altered the offspring LG and abn were found to have differences in DNA methylation, as compared to offspring of low-LG-ABN'mothers. These g differences emerged over the first week of life, were reversed with cross-fostering, persisted into adulthood and were associated g with altered histone acetylation and transcription factor (NGFI-A)binding to the GR promoter. Central infusion of a histone a deacetylase inhibitor removed the group differences in histone acetylation, DNA methylation, NGFI-A binding GR expression and hypothalamic-pituitary-adrenal(HPA)responses to stress, suggesting a causal relation among epigenomic state, GR expression nd the maternal effect on stress responses in the offspring Thus we show that an epigenomic state of a gene can be established through behavioral programming, and it is potentially reversible 8 Through undefined epigenetic processes, maternal effects influence inhibits CRF synthesis and release, thus dampening HPA responses to s the development of defensive responses to threat in organisms rang- stress". The adult offspring of high- compared with low-LG-ABN o ing from plants to mammals,. In the rat, such effects are mediated by mothers show increased hippocampal GR expression and enhanced mission of individual differences in stress responses from mother to high-LG-ABN mothers show decreased hypothalamic CRF expre s offspring -. Mother-pup contact in the rat primarily occurs within sion and more modest HPA responses to stress. Eliminating the dif- e litter, licks and grooms her pups, and nurses while occasionally experience on HPA responses to stress in adulthood 2, suggesting that licking and grooming the pups. There are stable individual differ- the difference in hippocampal GR expression serves as a mechanism ences in two forms of maternal behavior-LG and ABN--over the for the effect of early experience on the development of individual first week of lactation6-10. Such naturally occurring variations in differences in HPA responses to stress o maternal behavior are associated with the development of individual In vivo and in vitro studies suggest that maternal LG and ABN differences in behavioral and HPA responses to stress in the offspring. increase GR gene expression in the offspring through increased sero As adults, the offspring of high-LG-ABN' mothers are less fearful and tonin(5-HT)activity at 5-HT7 receptors, and the subsequent activa show more modest HPA responses to stress than the offspring of low- tion of cAMP and CAMP-dependent protein kinase activity3-15Both LG-ABN mothers"-. Cross-fostering studies show that the biological the in vitro effect of 5-HT and the in vivo effect of maternal behavior offspring of low-LG-ABN mothers reared by high-LG-abn dams on gR gene expression are accompanied by an increased hippocam resemble the normal offspring of high-LG-ABN mothers(and vice pal expression of nerve growth factor-inducible protein A(NGFI-A,a versa"). These findings suggest that variations in maternal behavior transcription factor also known as egr-1, krox-24, zenk and zif-268) serve as a mechanism for the nongenomic transmission of individual The non-coding exon I region of the hippocampal GR includes a pre differences in stress reactivity across generations, 5. 9. The critical moter region, exon 17, containing a binding site for NGFI-A6 question concerns the mechanisms whereby these maternal effects, or(Fig. la). Splice variants of the GR mRNA containing the exon 17 other forms of environmental ' programming, are sustained over the sequence are found predominantly in the brain, and the expression of lifespan of the animal GR mRNAs containing the exon 1, sequence is increased in the off- Maternal behavior in the rat permanently alters the development of spring of high-LG-ABN mothers or following manipulations that HPA responses to stress through tissue-specific effects on gene increase maternal licking and grooming(Weaver, L.C. G. et al., Soc. expression. The magnitude of the HPA response to acute stress is a Neurosci. Abstr. 697. 15, 2001), suggesting that the use of this promoter function of hypothalamic corticotropin-releasing factor (CRF) is enhanced as a function of maternal care. Although these findings release, which activates the pituitary-adrenal system. There are also might explain the increased GR expression in the neonate, we are left adulatory influences, such as glucocorticoid negative feedback that with the question of how the effect of maternal care might persist into Hospital Research Center, 6875 LaSalle Blvd., Montreal, Quebec H4H 1R3, Canada. 2McGill Program for the Study of Behaviour, Genes and Environment ology and Therapeutics, McGill University, 3655 Sir William Osler Promenade, Montreal, Quebec H3G 1Y6, Canada. Molecular Centre, Edinburgh University, Western General Hospital, Edinburgh EH4 2XU, UK. Correspondence should be addressed to M.J. M meaney @mcgill. ca)or M.S. ( moshe szyf@mcgill. ca). d online 27 June 2004; corrected 27 July 2004(details online); doi: 10.1038/nn1276 NATURE NEUROSCIENCE VOLUME 7 NUMBER 8 AUGUST 2004 847
ARTICLES Through undefined epigenetic processes, maternal effects influence the development of defensive responses to threat in organisms ranging from plants to mammals1,2. In the rat, such effects are mediated by variations in maternal behavior, which serve as the basis for the transmission of individual differences in stress responses from mother to offspring3–5. Mother-pup contact in the rat primarily occurs within the context of a nest-bout, which begins when the mother approaches the litter, licks and grooms her pups, and nurses while occasionally licking and grooming the pups6. There are stable individual differences in two forms of maternal behavior—LG and ABN—over the first week of lactation6–10. Such naturally occurring variations in maternal behavior are associated with the development of individual differences in behavioral and HPA responses to stress in the offspring. As adults, the offspring of ‘high-LG-ABN’ mothers are less fearful and show more modest HPA responses to stress than the offspring of ‘lowLG-ABN’ mothers6–9. Cross-fostering studies show that the biological offspring of low-LG-ABN mothers reared by high-LG-ABN dams resemble the normal offspring of high-LG-ABN mothers (and vice versa9). These findings suggest that variations in maternal behavior serve as a mechanism for the nongenomic transmission of individual differences in stress reactivity across generations4,5,9. The critical question concerns the mechanisms whereby these maternal effects, or other forms of environmental ‘programming’, are sustained over the lifespan of the animal. Maternal behavior in the rat permanently alters the development of HPA responses to stress through tissue-specific effects on gene expression. The magnitude of the HPA response to acute stress is a function of hypothalamic corticotropin-releasing factor (CRF) release, which activates the pituitary-adrenal system. There are also modulatory influences, such as glucocorticoid negative feedback that inhibits CRF synthesis and release, thus dampening HPA responses to stress11. The adult offspring of high- compared with low-LG-ABN mothers show increased hippocampal GR expression and enhanced glucocorticoid feedback sensitivity7,9. Predictably, adult offspring of high-LG-ABN mothers show decreased hypothalamic CRF expression and more modest HPA responses to stress7. Eliminating the difference in hippocampal GR levels abolishes the effects of early experience on HPA responses to stress in adulthood12, suggesting that the difference in hippocampal GR expression serves as a mechanism for the effect of early experience on the development of individual differences in HPA responses to stress5. In vivo and in vitro studies suggest that maternal LG and ABN increase GR gene expression in the offspring through increased serotonin (5-HT) activity at 5-HT7 receptors, and the subsequent activation of cAMP and cAMP-dependent protein kinase activity13–15. Both the in vitro effect of 5-HT and the in vivo effect of maternal behavior on GR gene expression are accompanied by an increased hippocampal expression of nerve growth factor-inducible protein A (NGFI-A, a transcription factor also known as egr-1, krox-24, zenk and zif-268). The non-coding exon 1 region of the hippocampal GR includes a promoter region, exon 17, containing a binding site for NGFI-A16 (Fig. 1a). Splice variants of the GR mRNA containing the exon 17 sequence are found predominantly in the brain, and the expression of GR mRNAs containing the exon 17 sequence is increased in the offspring of high-LG-ABN mothers or following manipulations that increase maternal licking and grooming16 (Weaver, I.C.G. et al., Soc. Neurosci. Abstr. 697.15, 2001), suggesting that the use of this promoter is enhanced as a function of maternal care. Although these findings might explain the increased GR expression in the neonate, we are left with the question of how the effect of maternal care might persist into 1Douglas Hospital Research Center, 6875 LaSalle Blvd., Montréal, Québec H4H 1R3, Canada. 2McGill Program for the Study of Behaviour, Genes and Environment and 3Department of Pharmacology and Therapeutics, McGill University, 3655 Sir William Osler Promenade, Montréal, Québec H3G 1Y6, Canada. 4Molecular Medicine Centre, Edinburgh University, Western General Hospital, Edinburgh EH4 2XU, UK. Correspondence should be addressed to M.J.M. (michael.meaney@mcgill.ca) or M.S. (moshe.szyf@mcgill.ca). Published online 27 June 2004; corrected 27 July 2004 (details online); doi:10.1038/nn1276 Epigenetic programming by maternal behavior Ian C G Weaver1,2, Nadia Cervoni3, Frances A Champagne1,2, Ana C D’Alessio3, Shakti Sharma1, Jonathan R Seckl4, Sergiy Dymov3, Moshe Szyf2,3 & Michael J Meaney1,2 Here we report that increased pup licking and grooming (LG) and arched-back nursing (ABN) by rat mothers altered the offspring epigenome at a glucocorticoid receptor (GR) gene promoter in the hippocampus. Offspring of mothers that showed high levels of LG and ABN were found to have differences in DNA methylation, as compared to offspring of ‘low-LG-ABN’ mothers. These differences emerged over the first week of life, were reversed with cross-fostering, persisted into adulthood and were associated with altered histone acetylation and transcription factor (NGFI-A) binding to the GR promoter. Central infusion of a histone deacetylase inhibitor removed the group differences in histone acetylation, DNA methylation, NGFI-A binding, GR expression and hypothalamic-pituitary-adrenal (HPA) responses to stress, suggesting a causal relation among epigenomic state, GR expression and the maternal effect on stress responses in the offspring. Thus we show that an epigenomic state of a gene can be established through behavioral programming, and it is potentially reversible. NATURE NEUROSCIENCE VOLUME 7 | NUMBER 8 | AUGUST 2004 847 © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES methylation of GR promoter. (a)Sequence map of the exon 17 GR promoter including the 17 gion b(encircled).(b, c)Methylation analysis the 17 CpG dinucleotides of the exon 17 GR promoter region from adult high-and low-LG ABN offspring (6-10 clones sequenced/animal n=4 animals/group; P90%), the effect of maternal care promoterand site-specific methylation. Hypomethylation of CpG must include neuronal as well as glial cells; both populations express dinucleotides of regulatory regions of genes is associated with active GR23,24 and NGFl-A25 genes chromatin ture and transcriptional activity.. Thus, the methylation pattern is a stable signature of the epigenomic status of a Cross-fostering reveals epigenetic marking by maternal behavior regulatory sequence. We focused on the methylation state of the exon Our findings suggest that specific sites within the exon 1, GR pro- 17 GR promoter, which is activated in the hippocampus in offspring moter are differentially methylated as a function of maternal behav- of high-LG-ABN mothers ior, but these findings are merely correlational. To directly examine To determine whether DNA methylation of specific target sites on the relation between maternal behavior and DNA methylation the gr promoter change in response to maternal care, we mapped within the exon 1, promoter, we performed an adoption study in differences in the methylation status of individual cytosines within which the biological offspring of high- or low-LG-ABN mothers the CpG dinucleotides of the exon 1, promoter from hippocampal were cross-fostered to either high-or low-LG-aBN dams within 12 h tissue from the adult offspring of high-and low-LG-ABN mothers. of birth. Cross-fostering produced a pattern of exon 1, promoter sodium bisulfite mapping. 22, with a particular interest in methylation that was associated with the rearing mother(F= 4.8, around the NGFl-A consensus sequence(Fig. la). The P<0.05; Fig. ld)and thus reversed the difference in methylation at wed significant differences in the methylation of specific specific cytosines, notably at the 5" CpG dinucleotide(site 16)of the 848 VOLUME 7 NUMBER 8 AUGUST 2004 NATURE NEUROSCIENCE
sites of the exon 17 GR promoter sequence (Fig. 1b,c). A two-way ANOVA revealed a highly significant effect of Group (F = 55.9, P 90%), the effect of maternal care must include neuronal as well as glial cells; both populations express GR23,24 and NGFI-A25 genes. Cross-fostering reveals epigenetic marking by maternal behavior Our findings suggest that specific sites within the exon 17 GR promoter are differentially methylated as a function of maternal behavior, but these findings are merely correlational. To directly examine the relation between maternal behavior and DNA methylation within the exon 17 promoter, we performed an adoption study in which the biological offspring of high- or low-LG-ABN mothers were cross-fostered to either high- or low-LG-ABN dams within 12 h of birth9. Cross-fostering produced a pattern of exon 17 promoter methylation that was associated with the rearing mother (F = 4.8, P < 0.05; Fig. 1d) and thus reversed the difference in methylation at specific cytosines, notably at the 5′ CpG dinucleotide (site 16) of the Figure 1 Maternal care alters cytosine methylation of GR promoter. (a) Sequence map of the exon 17 GR promoter including the 17 CpG dinucleotides (bold) and the NGFI-A binding region16 (encircled). (b,c) Methylation analysis of the 17 CpG dinucleotides of the exon 17 GR promoter region from adult high- and low-LGABN offspring (6–10 clones sequenced/animal; n = 4 animals/group; *P < 0.01). (b) Percentage of cytosine residues that were methylated (mean ± s.e.m.) for the first 15 CpG dinucleotides (*P < 0.05). (c) Percentage of methylated cytosines (mean ± s.e.m.) for the 5′ (site 16) and 3′ (site 17) CpG dinucleotides within the NGFI-A binding sequence (*P < 0.0001). (d) The effect of cross-fostering the offspring of high- and lowLG-ABN mothers on cytosine methylation of the 5′ and 3′ CpG dinucleotides within the NGFI-A binding sequence of the exon 17 GR promoter gene in adult hippocampi (n = 5 animals/group). L-L: animals born to and reared by low-LG-ABN mothers; H-H: animals born to and reared by high-LG-ABN mothers; H-L: animals born to high-LG-ABN mothers and reared by low-LG-ABN mothers; L-H: animals born to low-LG-ABN mothers and reared by high-LG-ABN mothers. (e) Percentage of cytosine methylation (mean ± s.e.m.) of the 5′ and 3′ CpG dinucleotides within the NGFI-A binding region of the exon 17 GR promoter gene in the offspring of high- or lowLG-ABN mothers (n = 5 animals/group; P < 0.001) as a function of age. There were no differences at any postnatal age in level of cytosine methylation of the 3′ CpG (site 17). ARTICLES adulthood. Gene expression is controlled by the epigenome, which is comprised of chromatin structure17 and DNA methylation18. We tested the hypothesis that maternal care alters DNA methylation of the GR exon 17 promoter, and that these changes are stably maintained into adulthood and associated with differences in GR expression and HPA responses to stress. RESULTS Maternal care and methylation of exon 17 promoter DNA methylation is a stable, epigenomic mark at CpG dinucleotides often associated with stable variations in gene transcription18–20. Two kinds of changes in DNA methylation are known to affect gene expression: regional, non-site specific DNA methylation around a promoter19 and site-specific methylation. Hypomethylation of CpG dinucleotides of regulatory regions of genes is associated with active chromatin structure and transcriptional activity18,20. Thus, the methylation pattern is a stable signature of the epigenomic status of a regulatory sequence. We focused on the methylation state of the exon 17 GR promoter, which is activated in the hippocampus in offspring of high-LG-ABN mothers. To determine whether DNA methylation of specific target sites on the GR promoter change in response to maternal care, we mapped differences in the methylation status of individual cytosines within the CpG dinucleotides of the exon 17 promoter from hippocampal tissue from the adult offspring of high- and low-LG-ABN mothers. We used sodium bisulfite mapping21,22, with a particular interest in the region around the NGFI-A consensus sequence (Fig. 1a). The results showed significant differences in the methylation of specific 848 VOLUME 7 | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE L-L H-H H-L L-H 0 20 40 60 80 100 C-methylation (%) L-L H-H H-L L-H 0 20 40 60 80 100 5´ CpG dinucleotide 3´ CpG dinucleotide High-LG/ABN Low-LG/ABN Age (d) E20 P1 P6 P21 P90 0 20 40 60 80 100 E20 P1 P6 P21 P90 0 20 40 60 80 100 * * * C-methylation (%) 5´ CpG dinucleotide 3´ CpG dinucleotide 1681 ccc 1741 ctctgctagtgtgacacactt1cg2cgcaactc3cgcagttgg4cggg5cg6cggaccacccctg7c 1801 ggctctgc8cggctggctgtcaccct9cgggggctctggctgc10cgaccca11cgggg12cgggct 1861 c13cgag14cggtt ccaagcct15cggagtggg16cggggg17cgggagggagcctgggagaa 11 14 15 16 17 18 19 110 111 2 5´ 3´ 1234 5 6 7 8 9 10 11 12 13 14 15 Region C-methylation (%) Low-LG/ABN High-LG-ABN 0 20 40 60 80 100 * * * * * * * 5´ 3´ CpG dinucleotide Low LG-ABN High LG-ABN * 0 20 40 60 80 100 a b c d e C-methylation (%) © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES LOW-LG/ABN h-LG/ABN Figure 2 Chromatin immunoprecipitation analysis of the association between histone H3-K9 acetylation and NGFl-A binding to the exon 17 GR sequence in hippocampal tissue from adult offspring of high- and low-LG- ABN mothers(n= 4 animals/group).(a, b)Lanes were loaded with non- (middle) primary antibody immunoprecipitated (A), or non-immune IgG antibody immuno-precipitated (N) hippocampal extracts).(a)Representative Southern blot of the amplified exon l7 region from acetyl-histone H3-K9 immunoprecipitated hippocampal tissue(194 bp band )and B-actin(171 bp b band)control. (b)Representative Southern blot of the amplified exon 17 GR exon 1, ion of the GR from NGFI-A immunoprecipitated hippocampal tissue (194 bp band). DNA loading was controlled using primers specific for the ubiquitously expressed B-actin promoter-o region. Exon 1b estrogen receptor-a promoter region, which does not contain NGFl-A recogniti elements(493 bp), amplified from the same NGFI-A immunoprecipitated hippocampal tissue was run as a control for specificity and showed no signal. (c)Relative optical density(ROD; m )of exon 17 2061日 sequence amplified from acetyl-histone H3-K9 or NGFI-A immunoprecipitated hippocampal tissue of adult high-and low-LG-ABN offspring(n= 4 animals/group: *P<0.001; **P<00001) 203 to examine the methylation status of the cytosines within the exon 1 GR promoter during development( Fig. le). Statistical analysis of the Acetyl H3K9 data for the 5 CpG(site 16)revealed a highly significant effect of Group(F= 66.7, P<00001)and Age(F=21.1, P<00001)as well as a significant interaction effect(F= 13.7, P<00001). Tukey post-hoc analysis revealed that the Group effect on methylation status of the 5 CpG(site 16)was significant at P6, P21 and P90(P < 0.001),but 9 NGFI-A consensus sequence(Fig. Id, left panel). Thus, in the not at E20 or PI. Just before birth(embryonic day 20; E20)the entire low-LG-ABN offspring that were fostered to high-LG-aBN dams, region was unmethylated in both groups. Strikingly, one day after methylation of this 5 site within the exon 1, promoter was indistin- birth(postnatal day 1; Pl)the exon 1, gr promoter was de novo a guishable from that of the biological offspring of high-LG-ABN methylated in both groups. The 5 and 3 CpG sites of the exon 1,GR mothers. Likewise, the methylation of the same 5" CpG dinucleotide NGFI-A response element in the offspring of both high- and low- in the biological offspring of high-LG-ABN mothers reared by low- LG-ABN mothers, which exhibit differential methylation later in life, There was no effect or mparable to that of low-LG-ABN offspring. were de novo methylated to the same extent. These data show that Lg-abn dams was co cross-fostering at the cytosine within the 3 CpG dinucleotide(site 17; Fig. ld) 0. These findings suggest that variations in maternal care directly alter TSA TSA 100 ng/ml Vehicle 100 ng/ml the methylation status of the exon 1, promoter of the GR gene. Thus Maternal care we have demonstrated that a DNA methylation pattern can be estab lished through a behavioral mode of programming without germ line ANIANIANI A N transmission In parental imprinting, a well-established paradigm of inheritance of an epigenomic mark, the paternally and maternally (acetyl-H3K9 IP) inherited alleles are differentially methylated. These methylation pat terns are defined during maturation of spermatocytes and oocytes, (acetyl-H3K9 IP) nd are transmitted to the offspring through the germ line- Timing of the maternal effect on DNA methylation -[--- The maternal care of high- and low-LG-ABN mothers differs only during the first week of life,. Thus, we wondered whether this period ER-a exon 1b to the Ing of the difference in NGFI-A DNA methylation in the offspring. We used sodium bisulfite mapping Figure 3 HDAC inhibitior (TSA) eliminates maternal effect on histone acetylation and NGFl-A binding (a)Chromatin immunoprecipitation nalysis of the association between histone H3-K9 acetylation and NGFI-A binding to the exon 17 GR promoter sequence in hippocampal tissue from vehicle- and TSA-treated (100 ng/ml) adult offspring of high- and low-LG- ABN mothers(n= 4 animals/group; lane labels as described in Fig. 2). b)Relative optical density(ROD; mean ts.e. m )of exon 17 sequence amplified from acetyl-histone H3-K9 or NGFl-A immunoprecipitate hippocampal tissue(P<0.05; **P<0.01) NATURE NEUROSCIENCE VOLUME 7 NUMBER 8 AUGUST 2004
ARTICLES NGFI-A consensus sequence (Fig. 1d, left panel). Thus, in the low-LG-ABN offspring that were fostered to high-LG-ABN dams, methylation of this 5′ site within the exon 17 promoter was indistinguishable from that of the biological offspring of high-LG-ABN mothers. Likewise, the methylation of the same 5′ CpG dinucleotide in the biological offspring of high-LG-ABN mothers reared by lowLG-ABN dams was comparable to that of low-LG-ABN offspring. There was no effect of cross-fostering at the cytosine within the 3′ CpG dinucleotide (site 17; Fig. 1d). These findings suggest that variations in maternal care directly alter the methylation status of the exon 17 promoter of the GR gene. Thus we have demonstrated that a DNA methylation pattern can be established through a behavioral mode of programming without germ line transmission. In parental imprinting, a well-established paradigm of inheritance of an epigenomic mark, the paternally and maternally inherited alleles are differentially methylated. These methylation patterns are defined during maturation of spermatocytes and oocytes, and are transmitted to the offspring through the germ line26. Timing of the maternal effect on DNA methylation The maternal care of high- and low-LG-ABN mothers differs only during the first week of life7,8. Thus, we wondered whether this period corresponds to the timing for the appearance of the difference in DNA methylation in the offspring. We used sodium bisulfite mapping to examine the methylation status of the cytosines within the exon 17 GR promoter during development (Fig. 1e). Statistical analysis of the data for the 5′ CpG (site 16) revealed a highly significant effect of Group (F = 66.7, P < 0.0001) and Age (F = 21.1, P < 0.0001) as well as a significant interaction effect (F = 13.7, P < 0.0001). Tukey post-hoc analysis revealed that the Group effect on methylation status of the 5′ CpG (site 16) was significant at P6, P21 and P90 (P < 0.001), but not at E20 or P1. Just before birth (embryonic day 20; E20) the entire region was unmethylated in both groups. Strikingly, one day after birth (postnatal day 1; P1) the exon 17 GR promoter was de novo methylated in both groups. The 5′ and 3′ CpG sites of the exon 17 GR NGFI-A response element in the offspring of both high- and lowLG-ABN mothers, which exhibit differential methylation later in life, were de novo methylated to the same extent. These data show that NATURE NEUROSCIENCE VOLUME 7 | NUMBER 8 | AUGUST 2004 849 Figure 2 Chromatin immunoprecipitation analysis of the association between histone H3-K9 acetylation and NGFI-A binding to the exon 17 GR sequence in hippocampal tissue from adult offspring of high- and low-LGABN mothers (n = 4 animals/group). (a,b) Lanes were loaded with nonimmunoprecipitated input (I), acetylated histone H3-K9 (top) or NGFI-A (middle) primary antibody immunoprecipitated (A), or non-immune IgG antibody immuno-precipitated (N) hippocampal extracts). (a) Representative Southern blot of the amplified exon 17 region from acetyl-histone H3-K9 immunoprecipitated hippocampal tissue (194 bp band) and β-actin (171 bp band) control. (b) Representative Southern blot of the amplified exon 17 region of the GR from NGFI-A immunoprecipitated hippocampal tissue (194 bp band). DNA loading was controlled using primers specific for the ubiquitously expressed β-actin promoter-α region. Exon 1b estrogen receptor-α promoter region, which does not contain NGFI-A recognition elements (493 bp), amplified from the same NGFI-A immunoprecipitated hippocampal tissue was run as a control for specificity and showed no signal. (c) Relative optical density (ROD; mean ± s.e.m.) of exon 17 sequence amplified from acetyl-histone H3-K9 or NGFI-A immunoprecipitated hippocampal tissue of adult high- and low-LG-ABN offspring (n = 4 animals/group; *P < 0.001; **P < 0.0001). Figure 3 HDAC inhibitior (TSA) eliminates maternal effect on histone acetylation and NGFI-A binding. (a) Chromatin immunoprecipitation analysis of the association between histone H3-K9 acetylation and NGFI-A binding to the exon 17 GR promoter sequence in hippocampal tissue from vehicle- and TSA-treated (100 ng/ml) adult offspring of high- and low-LGABN mothers (n = 4 animals/group; lane labels as described in Fig. 2). (b) Relative optical density (ROD; mean ± s.e.m.) of exon 17 sequence amplified from acetyl-histone H3-K9 or NGFI-A immunoprecipitated hippocampal tissue (*P < 0.05; **P < 0.01). © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES at the lysine-9(K9) residue of H3 and H4 histones is a well-estab ished marker of active chromatin/.29. Acetylation of the histone tails neutralizes the positively charged s,which disrupts his- tone binding to negatively charged DNA and thus promotes tran scription factor binding. We tested the hypothesis that the maternal effect on DNA methylation results in(i)increased histone acetyl- tion at the k9 residue of the H3 histone(s)associated with the exon 1, GR promoter and (ii) increased interaction between NGFI-A and the promoter sequence. We performed a chromatin immuno 123456789101112131415 precipitation(ChIP)analysis of histone H3-K9 acetylation and NGFI-A protein binding to the exon 1, GR promoter in the native chromatin environment in vivo Intact hippocampi from adult off- b avehicle: low LG/ABN spring of high- and low-LG-ABN mothers were crosslinked in vivo by paraformaldehyde perfusion. We then selectively immunopre cipitated protein-DNA complexes with either an acetylated H3-K9 histone primary antibody or an NGFI-A primary antibody. The protein-DNA complexes were uncrosslinked, and the precipitated genomic DNA was subjected to PCR amplification with primers pecific for the exon 1, GR promoter sequence. There were signifi cant Group effects for the association of both histone H3-K9 acety lation(t= 2.1, *P<0.001)and NGFI-A (t=3. 1, **P<00001)with 17 Gr These results indicated signifi- cantly greater histone H3-K9 acetylation association and threefold Figure 4 TSA effects on cytosine methylation. (a, b)Methylation analysis of greater binding of NGFI-A protein to the hippocampal exon 1,GR e the 17 CpG dinucleotides of the exon 1, GR promoter in hippocampi of promoter in the adult offspring of high- compared with low-LG- G ABN mothers (n= 5 animals/group).(a)Percentage of cytosine residues GR promoter involves DNA methylation, histone H3-K9 acetyla that were methylated(mean+ s.e. m )for the first 15 CpG dinucleotides tion and alterations in ngFi-a binding (P<0.05).(b)Percentage of methylated cytosines for the 5(site 16)and 3(site 17)CpG dinucleotides within the NgFl-a binding region (P<0.001;**P<0.003) Reversal of maternally mediated epigenetic marking These findings suggest that maternal care influences hippocampal GR expression, and thus HPA function in the offspring, through epigenetic alterations that regulate NGFl-A binding to the exon 1, promoter. A both the basal state of methylation and the first wave of de novo critical question is whether the impact of early experience is reversible methylation after birth occur similarly in both groups. Whereas it is and whether epigenetic programming is modifiable in adult, post generally accepted that DNA methylation patterns are formed prena- mitotic tissues? The generally accepted model is that the DNA methyla- o tally and that de novo methylation occurs early in development, there tion pattern is an irreversible reaction in adult post-mitotic cells is at least one documented example of postnatal de novo methylation However, recent data from in vitro experiments suggests that in certain of the Hoxa5 and Hoxb5 genes27 Because similar analyses are not doc- instances it is possible to induce replication-independent demethylation umented for other genes, it remains unknown whether changes in of ectopically methylated genes by increasing histone acetylation us ethylation are common around birth or whether they are unique to the histone deacetylase(HDAC) inhibitor trichostatin A(TSA)29,30 Cytosine methylation attracts methylated DNA binding proteins and The differences in the methylation status of the exon 1, GR pro- HDACs that prevent histone acetylation and thus transcription factor moter between the two groups developed between PI and P6, the binding29, 30. Activation of chromatin through HDAC inhibition might period when differences in the maternal behavior of high-and low- trigger DNA demethylation by increasing the accessibility of DNA to LG-ABN dams are apparent. 8. By P6, the NGFI-A response element demethylase activity 0. We tested the hypothesis that inhibition of 5 CpG dinucleotide (site 16) was effectively demethylated in the HDACs with TSA would result in increased K9 acetylation of H3-his- high-, but not in the low-LG-ABN group. The group difference in tones associated with the exon 1, GR promoter, DNA demethylation, CpG dinucleotide methylation remains consistent through to adult- NGFl-A binding and reversal of maternal programming of str hood (P90; Fig. le). These findings, together with those of the cross- responses in the adult offspring of low-LG-ABN mothers fostering study, suggest that the group difference in DNA We first used ChIP analysis to determine whether histone H3-K9 ethylation occurs as a function of a maternal behavior over the acetylation and NGFl-A protein binding to the exon 17 gr pro first week of life. The results of earlier studies indicate that the first moter is altered in the offspring of high-and low-LG-ABN mothers week of postnatal life is a 'critical period'for the effects of early through intracerebroventricular (i.c.v. ) infusion of the adult off- experience on hippocampal GR express pring with TSA (100 ng/ml)or vehicle. Statistical analysis revealed a significant Group x Treatment interaction effect for both the his- Maternal effects on chromatin structure and NGFI-A binding tone H3-K9 acetylation(F=4.93, P<0.05)and NGFI-A(F=8.9 The next question concerns the functional importance of such dif- P=0.01). Post-hoc analysis showed that for both assays, vehicle ferences in methylation. DNA methylation is associated with treated offspring of low-LG-ABN mothers showed significantly changes in chromatin activity states. Chromatin gates the accessi- ("P<0.01)less association than any other group. These results indi- bility of promoters to transcription factors. Histone acetylation cate greater histone H3-K9 acetylation association and more bind 850 VOLUME 7 NUMBER 8 AUGUST 2004 NATURE NEUROSCIENCE
ARTICLES both the basal state of methylation and the first wave of de novo methylation after birth occur similarly in both groups. Whereas it is generally accepted that DNA methylation patterns are formed prenatally and that de novo methylation occurs early in development, there is at least one documented example of postnatal de novo methylation of the Hoxa5 and Hoxb5 genes27. Because similar analyses are not documented for other genes, it remains unknown whether changes in methylation are common around birth or whether they are unique to this GR promoter. The differences in the methylation status of the exon 17 GR promoter between the two groups developed between P1 and P6, the period when differences in the maternal behavior of high- and lowLG-ABN dams are apparent5,8. By P6, the NGFI-A response element 5′ CpG dinucleotide (site 16) was effectively ‘demethylated’ in the high-, but not in the low-LG-ABN group. The group difference in CpG dinucleotide methylation remains consistent through to adulthood (P90; Fig. 1e). These findings, together with those of the crossfostering study, suggest that the group difference in DNA methylation occurs as a function of a maternal behavior over the first week of life. The results of earlier studies indicate that the first week of postnatal life is a ‘critical period’ for the effects of early experience on hippocampal GR expression28. Maternal effects on chromatin structure and NGFI-A binding The next question concerns the functional importance of such differences in methylation. DNA methylation is associated with changes in chromatin activity states18. Chromatin gates the accessibility of promoters to transcription factors17. Histone acetylation at the lysine-9 (K9) residue of H3 and H4 histones is a well-established marker of active chromatin17,29. Acetylation of the histone tails neutralizes the positively charged histones, which disrupts histone binding to negatively charged DNA and thus promotes transcription factor binding. We tested the hypothesis that the maternal effect on DNA methylation results in (i) increased histone acetylation at the K9 residue of the H3 histone(s) associated with the exon 17 GR promoter and (ii) increased interaction between NGFI-A and the promoter sequence. We performed a chromatin immunoprecipitation (ChIP) analysis of histone H3-K9 acetylation and NGFI-A protein binding to the exon 17 GR promoter in the native chromatin environment in vivo. Intact hippocampi from adult offspring of high- and low-LG-ABN mothers were crosslinked in vivo by paraformaldehyde perfusion. We then selectively immunoprecipitated protein-DNA complexes with either an acetylated H3-K9 histone primary antibody or an NGFI-A primary antibody. The protein-DNA complexes were uncrosslinked, and the precipitated genomic DNA was subjected to PCR amplification with primers specific for the exon 17 GR promoter sequence. There were significant Group effects for the association of both histone H3-K9 acetylation (t = 2.1, *P < 0.001) and NGFI-A (t = 3.1, **P < 0.0001) with the exon 17 GR promoter sequence. These results indicated significantly greater histone H3-K9 acetylation association and threefold greater binding of NGFI-A protein to the hippocampal exon 17 GR promoter in the adult offspring of high- compared with low-LGABN mothers (Fig. 2). Thus, maternal programming of the exon 17 GR promoter involves DNA methylation, histone H3-K9 acetylation and alterations in NGFI-A binding. Reversal of maternally mediated epigenetic marking These findings suggest that maternal care influences hippocampal GR expression, and thus HPA function in the offspring, through epigenetic alterations that regulate NGFI-A binding to the exon 17 promoter. A critical question is whether the impact of early experience is reversible and whether epigenetic programming is modifiable in adult, postmitotic tissues? The generally accepted model is that the DNA methylation pattern is an irreversible reaction in adult post-mitotic cells. However, recent data from in vitro experiments suggests that in certain instances it is possible to induce replication-independent demethylation of ectopically methylated genes by increasing histone acetylation using the histone deacetylase (HDAC) inhibitor trichostatin A (TSA)29,30. Cytosine methylation attracts methylated DNA binding proteins and HDACs that prevent histone acetylation and thus transcription factor binding29,30. Activation of chromatin through HDAC inhibition might trigger DNA demethylation by increasing the accessibility of DNA to demethylase activity30. We tested the hypothesis that inhibition of HDACs with TSA would result in increased K9 acetylation of H3-histones associated with the exon 17 GR promoter, DNA demethylation, NGFI-A binding and reversal of maternal programming of stress responses in the adult offspring of low-LG-ABN mothers. We first used ChIP analysis to determine whether histone H3-K9 acetylation and NGFI-A protein binding to the exon 17 GR promoter is altered in the offspring of high- and low-LG-ABN mothers through intracerebroventricular (i.c.v.) infusion of the adult offspring with TSA (100 ng/ml) or vehicle. Statistical analysis revealed a significant Group × Treatment interaction effect for both the histone H3-K9 acetylation (F = 4.93, P < 0.05) and NGFI-A (F = 8.97, P = 0.01). Post-hoc analysis showed that for both assays, vehicle - treated offspring of low-LG-ABN mothers showed significantly (*P < 0.01) less association than any other group. These results indicate greater histone H3-K9 acetylation association and more bind- 850 VOLUME 7 | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE Figure 4 TSA effects on cytosine methylation. (a,b) Methylation analysis of the 17 CpG dinucleotides of the exon 17 GR promoter in hippocampi of vehicle- and TSA-treated (100 ng/ml) adult offspring of high- and low-LGABN mothers (n = 5 animals/group). (a) Percentage of cytosine residues that were methylated (mean ± s.e.m.) for the first 15 CpG dinucleotides (*P < 0.05). (b) Percentage of methylated cytosines for the 5′ (site 16) and 3′ (site 17) CpG dinucleotides within the NGFI-A binding region (*P < 0.001; **P < 0.003). © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES (>3 fold) of NGFI-A protein to the hippocampal exon 1, gr a Treatment - Vehicle TSA promoter in the adult offspring of TSA-treated low-LG-ABN moth ers compared with the vehicle-treated offspring of low-LG-ABN LG-ABN*Low High Low High mothers(Fig 3); there were no significant differences between TSA treated offspring of low-LG-ABN mothers and either TSA- or vehi- aGR92kDa→ cle-treated offspring of high-LG-ABN dams. As expected, TSA a-tubulin 60 kD reatment did not change histone H3-K9 acetylation or NGFI-A binding in the adult offspring of high-LG-ABN mothers, because the GR exon 1, promoter region in the offspring of high-LG-ABN g401 mothers is normally associated with acetylated histones and highly bound with NGFI-A To determine whether TSA treatment reverses the maternal effect on methylation within specific CpG dinucleotides on the exon 17 GR promoter, we mapped the differences in methylation using the 8 sodium bisulfite technique, focusing on the NGFI-A consensus Vehicl sequence within the exon 1, region(Fig. la). Statistical analysis of the data across all 17 sites revealed a significant effect of Group b S (F=93. 2, P<00001 ), Treatment(F= 52.8, P<00001)and Region (F= 30.4, P<00001), as well as a significant Group xTreatment x -O- TSA high-LG/ABN a Region interaction(F= 2.1, P=0.01), Group x Treatment interac tion(F= 19.9, P< 0.0001), Group x Region interaction(F= 4.1, P< 0.0001) and Treatment x Region interaction(F= 2.8, P<00001). The results again revealed significant differences in the of regions of the exon 1, GR promoter sequence(Fig 4)with significant differences within the 5" CpG(site 8 16)and 3 CpG(site 17) dinucleotides of the NGFI-A consensus Before1020406090 s sequence(Fig. 4b). Statistical analysis of the data from these two o sites revealed a highly significant effect of Group (F= 43.8, Time(min) P<00001), Treatment(F= 65.3, P< 00001)and Region Figure 5 TSA eliminates the maternal effect on hippocampal GR (F=113.3, P<00001), as well as a significant Group x Treatment ression and hPa res o stress. (a)Top: a represe a Interaction(F= 16.0, P 0.0001), Group x Region interaction blot showing absolute levels of electrophoresed hippocampal GR (F=37.8, P<00001)and Treatment x Region interaction(F=4.5, immunoreactivity(IR)from vehicle- and TSA(100 ng/ml)-treated adult P=0.04). Post-hoc analysis revealed that TSA treatment signifi- offspring of high-or low-LG-ABN mothers Molecular weight markers cantly decreased the degree of cytosine methylation within the 5'(SeeBlue, Santa Cruz Biotech)correspond to a single major band at 92 (site 16)CpG dinucleotide of the NGFI-A binding region of the kDa. The middle panel shows the membrane reprobed for a-tubulin I exon 1, GR promoter in the offspring of low-LG-ABN mothers illustrating absolute levels of electrophoresed hippocampal protein bound o comparison to vehicle-treated low-LG-ABN mothers('P<0.001).major band at -60 kDa and the intensity of the signal was similar in all TSA treatment produced'demethylation' of the 5 CpG(site 16) lanes. The lower panel shows quantitative densitometric analysis(relative and 3 CpG(site 17)dinucleotides in the offspring of low-LG-ABN optical density, ROD)of GR IR levels from samples(n= 5 animals/group mothers, and hypomethylation of the 3'CpG(site 17) dinucleotide P<0.001).(b)Plasma corticosterone responses(mean ts.e. m )to a in the offspring of high-LG-ABN mothers(Fig. 4b). These findings 20-min period of restraint stress (solid bar) in vehicle- and TSA suggest that TSA treatment can reverse the hypermethylated status of (100 ng/mp-treated adult offspring of high- or low-LG-ABN mothers the exon 1,GR promoter in the offspring of low-LG-ABN mothers. (n=10 animals/group:"P<0.01) TSA treatment resulted in a more extensive change in DNA methyla- tion than maternal care per se, since the 3 CpG (site 17) dinu- cleotide, which is unaffected by maternal behavior, is partially NGFI-A response element, we found that methylation of the cyto demethylated in response to TSA treatment in both cohorts sine within the 5 CpG dinucleotide(site 16)completely eliminated (Fig 4b). Also, as in the original study(Fig 1b), maternal care altered the binding of NGFI-A, whereas methylation of the cytosine within he methylation status of other CpG dinucleotides in the exon 1, the 3 CpG dinucleotide(site 17)only slightly reduced NGFI-A pro- sequence; in the case of sites 1, 2, 5, 12, 14 and 15, these effects were tein binding(IC G W, M.S.& M.J. M, unpublished data) similarly reversed with central TSA infusion. The significance of these sites for transcription factor binding is currently unknown and Reversal of maternal effect on GR expression hus a focus of ongoing studies. Thus, stable DNA methylation GR gene expression in the hippocampus is increased in the adult marking by maternal behavior is reversible in the adult offspring offspring of high- compared with low-LG-ABN mothers.We hippocampus by pharmacological modulation of chromatin struc- suggest that such differences are mediated by the differential ture. While TSa altered the methylation of the both the 5 and 3 methylation of the 5 CpG dinucleotide(site 16)of the NGFI-A CpG sites within the NGFI-A response element, the former appears consensus sequence in the exon 1, GR promoter and the subse to be critical for the effect on NGFl-A binding to the exon 1, pro- quent alteration of histone acetylation and NGFI-A binding to the moter. In a previous in vitro study using electrophilic mobility shift exon 17 sequence. If the differential epigenetic marking regulates assays(EMSA)with purified recombinant NGFI-A protein and the expression of the exon 17 GR promoter in high -versus low-LG differentially methylated oligonucleotide sequences containing the offspring, then reversal of the epigenetic marking should be accom NATURE NEUROSCIENCE VOLUME 7 NUMBER 8 AUGUST 2004 851
ARTICLES ing (>3 fold) of NGFI-A protein to the hippocampal exon 17 GR promoter in the adult offspring of TSA-treated low-LG-ABN mothers compared with the vehicle-treated offspring of low-LG-ABN mothers (Fig. 3); there were no significant differences between TSAtreated offspring of low-LG-ABN mothers and either TSA- or vehicle-treated offspring of high-LG-ABN dams. As expected, TSA treatment did not change histone H3-K9 acetylation or NGFI-A binding in the adult offspring of high-LG-ABN mothers, because the GR exon 17 promoter region in the offspring of high-LG-ABN mothers is normally associated with acetylated histones and highly bound with NGFI-A. To determine whether TSA treatment reverses the maternal effect on methylation within specific CpG dinucleotides on the exon 17 GR promoter, we mapped the differences in methylation using the sodium bisulfite technique, focusing on the NGFI-A consensus sequence within the exon 17 region (Fig. 1a). Statistical analysis of the data across all 17 sites revealed a significant effect of Group (F = 93.2, P < 0.0001), Treatment (F = 52.8, P < 0.0001) and Region (F = 30.4, P < 0.0001), as well as a significant Group × Treatment × Region interaction (F = 2.1, P = 0.01), Group × Treatment interaction (F = 19.9, P < 0.0001), Group × Region interaction (F = 4.1, P < 0.0001) and Treatment × Region interaction (F = 2.8, P < 0.0001). The results again revealed significant differences in the methylation of a number of regions of the exon 17 GR promoter sequence (Fig. 4) with significant differences within the 5′ CpG (site 16) and 3′ CpG (site 17) dinucleotides of the NGFI-A consensus sequence (Fig. 4b). Statistical analysis of the data from these two sites revealed a highly significant effect of Group (F = 43.8, P < 0.0001), Treatment (F = 65.3, P < 0.0001) and Region (F = 113.3, P < 0.0001), as well as a significant Group × Treatment interaction (F = 16.0, P < 0.0001), Group × Region interaction (F = 37.8, P < 0.0001) and Treatment × Region interaction (F = 4.5, P = 0.04). Post-hoc analysis revealed that TSA treatment significantly decreased the degree of cytosine methylation within the 5′ (site 16) CpG dinucleotide of the NGFI-A binding region of the exon 17 GR promoter in the offspring of low-LG-ABN mothers in comparison to vehicle-treated low-LG-ABN mothers (*P < 0.001). TSA treatment produced ‘demethylation’ of the 5′ CpG (site 16) and 3′ CpG (site 17) dinucleotides in the offspring of low-LG-ABN mothers, and hypomethylation of the 3′ CpG (site 17) dinucleotide in the offspring of high-LG-ABN mothers (Fig. 4b). These findings suggest that TSA treatment can reverse the hypermethylated status of the exon 17 GR promoter in the offspring of low-LG-ABN mothers. TSA treatment resulted in a more extensive change in DNA methylation than maternal care per se, since the 3′ CpG (site 17) dinucleotide, which is unaffected by maternal behavior, is partially ‘demethylated’ in response to TSA treatment in both cohorts (Fig. 4b). Also, as in the original study (Fig. 1b), maternal care altered the methylation status of other CpG dinucleotides in the exon 17 sequence; in the case of sites 1, 2, 5, 12, 14 and 15, these effects were similarly reversed with central TSA infusion. The significance of these sites for transcription factor binding is currently unknown and thus a focus of ongoing studies. Thus, stable DNA methylation marking by maternal behavior is reversible in the adult offspring hippocampus by pharmacological modulation of chromatin structure. While TSA altered the methylation of the both the 5′ and 3′ CpG sites within the NGFI-A response element, the former appears to be critical for the effect on NGFI-A binding to the exon 17 promoter. In a previous in vitro study using electrophilic mobility shift assays (EMSA) with purified recombinant NGFI-A protein31 and differentially methylated oligonucleotide sequences containing the NGFI-A response element, we found that methylation of the cytosine within the 5′ CpG dinucleotide (site 16) completely eliminated the binding of NGFI-A, whereas methylation of the cytosine within the 3′ CpG dinucleotide (site 17) only slightly reduced NGFI-A protein binding (I.C.G.W., M.S. & M.J.M., unpublished data). Reversal of maternal effect on GR expression GR gene expression in the hippocampus is increased in the adult offspring of high- compared with low-LG-ABN mothers7,9. We suggest that such differences are mediated by the differential methylation of the 5′ CpG dinucleotide (site 16) of the NGFI-A consensus sequence in the exon 17 GR promoter and the subsequent alteration of histone acetylation and NGFI-A binding to the exon 17 sequence. If the differential epigenetic marking regulates the expression of the exon 17 GR promoter in high- versus low-LG offspring, then reversal of the epigenetic marking should be accomNATURE NEUROSCIENCE VOLUME 7 | NUMBER 8 | AUGUST 2004 851 Figure 5 TSA eliminates the maternal effect on hippocampal GR expression and HPA responses to stress. (a) Top: a representative western blot showing absolute levels of electrophoresed hippocampal GR immunoreactivity (IR) from vehicle- and TSA (100 ng/ml)-treated adult offspring of high- or low-LG-ABN mothers. Molecular weight markers (SeeBlue, Santa Cruz Biotech) correspond to a single major band at 92 kDa. The middle panel shows the membrane reprobed for α-tubulin IR, illustrating absolute levels of electrophoresed hippocampal protein bound to the transfer membrane. Molecular weight markers correspond to a single major band at ∼60 kDa and the intensity of the signal was similar in all lanes. The lower panel shows quantitative densitometric analysis (relative optical density, ROD) of GR IR levels from samples (n = 5 animals/group; *P < 0.001). (b) Plasma corticosterone responses7 (mean ± s.e.m.) to a 20-min period of restraint stress (solid bar) in vehicle- and TSA (100 ng/ml)-treated adult offspring of high- or low-LG-ABN mothers (n = 10 animals/group; *P < 0.01). © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES panied by an increase in hippocampal GR expression. This hypoth- thylated exon 1, GR promoter contributes to the attenuation of Gr esis is supported by the results(Fig 5a)showing that hippocampal expression in low-LG-ABN adult offspring, whereas increased NGFI GR expression was significantly increased in TSA-treated offspring A binding to the hyperacetylated and hypomethylated response ele- of low-LG-ABN mothers to levels that were comparable to those of ment on the exon 1, Gr promoter in the offspring of the either the vehicle- or TSA-treated offspring of high-LG-abn high-LG-ABN mothers would serve to maintain the differences in mothers. ANOVA revealed highly significant main effects of Group gene expression. DNA methylation represents a stable epigenetic (F=7.4, P=0.01)and Dose(F=24.8, P0.90). histone acetylation and NGFI-A binding remains to be defined. Ithough TSA treatment significantly induced GR expression in Nevertheless, our findings provide the first evidence that maternal low-LG-ABN adult offspring, global abundance of protein in the behavior produces stable alterations of DNA methylation and chro- s hippocampus was not apparently increased, as indicated by the matin structure, providing a mechanism for the long-term effects of equal a-tubulin immunoreactivity(Fig. 5a). In comparing the maternal care on gene expression in the offspring. These studies offer a vehicle-treated groups, note that the effect of maternal care on GR an opportunity to clearly define the nature of gene-environment gene expression.9 is subtler than the more pronounced effect on interactions during development and how such effects result in the the methylation status of the 5 CpG dinucleotide(site 16) within sustained environmental programming of gene expression and the exon 1, promoter(Fig 4b).However, in previous studies 6 we function over the lifespan. It is important to note that maternal E found evidence for multiple promoters reg ulating ects on expression of defensive responses, such as increased g Pession suggesting that exon 1, is but one of the regulatory HPA activity, are a common theme in biology. such that the magni- 8 sequences determining GR expression within the hippocamp ude of the maternal influence on the development of HPA and behavioral responses to stress in the rat should not be surprising o Reversal of maternal effect on HPA responses to stress Maternal effects on defensive responses to threat are apparent in As adults, the offspring of high-LG-ABN mothers show more mod- plants, insects and reptiles. Such effects commonly follow from the est HPA responses to stress than the offspring of low-LG-ABn exposure of the mother to the same or similar forms of threat and mothers. The effect of maternal care on HPA responses to stress may represent examples whereby the experience of the mother is seems to be, in part, associated with differences in hippocampal Gr translated through an epigenetic mechanism of inheritance into levels and glucocorticoid negative feedback sensitivity?. Given that phenotypic variation in the offspring. Thus, maternal effects could TSA treatment reversed the group difference in hippocampal gr result in the transmission of adaptive responses across genera- expression, we examined the adrenocortical responses to stress in a tions,. Indeed, among mammals, natural selection may have separate cohort of vehicle- and TSA-treated animals. Central infu- shaped offspring to respond to subtle variations in parental behavior sion of TSA completely eliminated the maternal effect on HPA as a forecast of the environmental conditions they will ultimately responses to acute stress( Fig 5b). Statistical analysis of the plasma face once they become independent of the parent. Epigenetic modi- corticosterone data revealed significant effects of Group(F=4.3, fications of targeted regulatory sequences in response to even rea- P=0.048), Treatment(F=4.3, P=0.046)and Time (F=27.3, sonably subtle variations in environmental conditions might then P<00001), as well as a significant Group X Treatment interaction serve as a major source of epigenetic variation in gene expression and effect(F=7.7, P=0.009). Post-hoc analysis revealed that TSA treat- function, and ultimately as a process mediating such maternal ment significantly decreased basal plasma corticosterone in the off- effects. We propose that effects on chromatin structure such as those pring of low-LG-aBn mothers to levels comparable to those of described here serve as an intermediate process that imprints high-LG-ABN animals. Thus, plasma corticosterone responses to dynamic environmental experiences on the fixed genome, resulting restraint stress in the vehicle-treated adult offspring of low-LG- in stable alterations in phenotype ABN mothers were significantly(P 0.01) greater than those of TSA- and vehicle-treated adult offspring of high-LG-ABN mothers METHODS response to stress in the offspring of high-LG-ABN mothers was from Long-Evans hooded rats born in our colony from animals originally unaffected by TSA treatment obtained from Charles River Canada(St Constant, Quebec). All procedures In summary, central infusion of the HDAC inhibitor TSA enhanced were performed according to guidelines developed by the Canadian Council histone H3-K9 acetylation of the exon 1, GR promoter in the off- on Animal Care and protocol approved by the McGill University Animal Care spring of the low-LG-ABN mothers, increased NGFI-A binding to its Committee. Maternal behavior was scored and the adoption study was per- cognate sequence, induced hypomethylation of CpG dinucleotide formed as previously described. For further methodological details, see sequences in the promoter and eliminated the maternal effect on hi Supplementary Methods online. pocampal GR expression and the HPA response to stress. Sodium bisulfite mapping. Sodium bisulfite mapping was performed a These findings are consistent with idea that the maternal effect on previously described21, 22. The rat GR exon 1, genomic region(GenBank GR expression and HPA responses to stress is mediated by alterations accession number AJ271870)of the sodium bisulfite-treated hippocampal in chromatin structure. We propose that the reduced binding of DNA (50 ng/ml) was subjected to PCR amplification using outside primers NGFl-A to its response element on the hypoacetylated and hyperme-(forward: 1646-TTTTTTAGGTTTTTTTAGAGGG-1667: reverse: 1930- 852 VOLUME 7 NUMBER 8 AUGUST 2004 NATURE NEUROSCIENCE
ARTICLES panied by an increase in hippocampal GR expression. This hypothesis is supported by the results (Fig. 5a) showing that hippocampal GR expression was significantly increased in TSA-treated offspring of low-LG-ABN mothers to levels that were comparable to those of either the vehicle- or TSA-treated offspring of high-LG-ABN mothers. ANOVA revealed highly significant main effects of Group (F = 7.4, P = 0.01) and Dose (F = 24.8, P 0.90). Although TSA treatment significantly induced GR expression in low-LG-ABN adult offspring, global abundance of protein in the hippocampus was not apparently increased, as indicated by the equal α-tubulin immunoreactivity (Fig. 5a). In comparing the vehicle-treated groups, note that the effect of maternal care on GR gene expression7,9 is subtler than the more pronounced effect on the methylation status of the 5′ CpG dinucleotide (site 16) within the exon 17 promoter (Fig. 4b). However, in previous studies16 we found evidence for multiple promoters regulating hippocampal GR expression suggesting that exon 17 is but one of the regulatory sequences determining GR expression within the hippocampus. Reversal of maternal effect on HPA responses to stress As adults, the offspring of high-LG-ABN mothers show more modest HPA responses to stress than the offspring of low-LG-ABN mothers7. The effect of maternal care on HPA responses to stress seems to be, in part, associated with differences in hippocampal GR levels and glucocorticoid negative feedback sensitivity7. Given that TSA treatment reversed the group difference in hippocampal GR expression, we examined the adrenocortical responses to stress in a separate cohort of vehicle- and TSA-treated animals. Central infusion of TSA completely eliminated the maternal effect on HPA responses to acute stress (Fig. 5b). Statistical analysis of the plasma corticosterone data revealed significant effects of Group (F = 4.3, P = 0.048), Treatment (F = 4.3, P = 0.046) and Time (F = 27.3, P < 0.0001), as well as a significant Group × Treatment interaction effect (F = 7.7, P = 0.009). Post-hoc analysis revealed that TSA treatment significantly decreased basal plasma corticosterone in the offspring of low-LG-ABN mothers to levels comparable to those of high-LG-ABN animals. Thus, plasma corticosterone responses to restraint stress in the vehicle-treated adult offspring of low-LGABN mothers were significantly (P < 0.01) greater than those of TSA- and vehicle-treated adult offspring of high-LG-ABN mothers or TSA-treated offspring of Low-LG-ABN mothers. The HPA response to stress in the offspring of high-LG-ABN mothers was unaffected by TSA treatment. In summary, central infusion of the HDAC inhibitor TSA enhanced histone H3-K9 acetylation of the exon 17 GR promoter in the offspring of the low-LG-ABN mothers, increased NGFI-A binding to its cognate sequence, induced hypomethylation of CpG dinucleotide sequences in the promoter and eliminated the maternal effect on hippocampal GR expression and the HPA response to stress. These findings are consistent with idea that the maternal effect on GR expression and HPA responses to stress is mediated by alterations in chromatin structure. We propose that the reduced binding of NGFI-A to its response element on the hypoacetylated and hypermethylated exon 17 GR promoter contributes to the attenuation of GR expression in low-LG-ABN adult offspring, whereas increased NGFIA binding to the hyperacetylated and hypomethylated response element on the exon 17 GR promoter in the offspring of the high-LG-ABN mothers would serve to maintain the differences in gene expression. DNA methylation represents a stable epigenetic mark; therefore, our findings provide an explanation for the enduring effect on mother-infant interactions over the first week of postnatal life on HPA responses to stress in the offspring. DISCUSSION Further studies are required to determine how maternal behavior alters the epigenetic status of the exon 17 GR promoter. In addition, the exact causal relationship between DNA methylation and altered histone acetylation and NGFI-A binding remains to be defined. Nevertheless, our findings provide the first evidence that maternal behavior produces stable alterations of DNA methylation and chromatin structure, providing a mechanism for the long-term effects of maternal care on gene expression in the offspring. These studies offer an opportunity to clearly define the nature of gene-environment interactions during development and how such effects result in the sustained ‘environmental programming’ of gene expression and function over the lifespan. It is important to note that maternal effects on the expression of defensive responses, such as increased HPA activity, are a common theme in biology1,2 such that the magnitude of the maternal influence on the development of HPA and behavioral responses to stress in the rat should not be surprising. Maternal effects on defensive responses to threat are apparent in plants, insects and reptiles. Such effects commonly follow from the exposure of the mother to the same or similar forms of threat and may represent examples whereby the experience of the mother is translated through an epigenetic mechanism of inheritance into phenotypic variation in the offspring. Thus, maternal effects could result in the transmission of adaptive responses across generations1,2,5. Indeed, among mammals, natural selection may have shaped offspring to respond to subtle variations in parental behavior as a forecast of the environmental conditions they will ultimately face once they become independent of the parent5. Epigenetic modifications of targeted regulatory sequences in response to even reasonably subtle variations in environmental conditions might then serve as a major source of epigenetic variation in gene expression and function, and ultimately as a process mediating such maternal effects. We propose that effects on chromatin structure such as those described here serve as an intermediate process that imprints dynamic environmental experiences on the fixed genome, resulting in stable alterations in phenotype. METHODS Animals and maternal behavior. The animals used in all studies were derived from Long-Evans hooded rats born in our colony from animals originally obtained from Charles River Canada (St. Constant, Québec). All procedures were performed according to guidelines developed by the Canadian Council on Animal Care and protocol approved by the McGill University Animal Care Committee. Maternal behavior was scored32 and the adoption study was performed9 as previously described. For further methodological details, see Supplementary Methods online. Sodium bisulfite mapping. Sodium bisulfite mapping was performed as previously described21,22. The rat GR exon 17 genomic region (GenBank accession number AJ271870) of the sodium bisulfite-treated hippocampal DNA (50 ng/ml) was subjected to PCR amplification using outside primers (forward: 1646-TTTTTTAGGTTTTTTTAGAGGG-1667; reverse: 1930- 852 VOLUME 7 | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES ATTTCTTTAATTTCTCTTCTCC-1908). The thermocycler protocol ple, the ROd value of the band within the antibody lane(A) was divided by the involved an initial denaturation cycle (5 min, 95C), 34 cycles of denatura- ROD value of the band within the input lane (1). To control for equal loading tion(I min, 95C), annealing(2 min 30 s, 56C)and extension(I min, 72 between samples, the final signal of the exon 17 GR promoter, amplified fror eC), followed by a final extension cycle(5 min, 72oC)terminating at the acetyl-histone H3-K9 immunoprecipitations, was divided by the final sig- 4C. The PCR product(285 bp)was used as a template for subsequent PCR nal from the p-actin promoter-a amplified from the same precipitate reactions using nested primers(forward: 1738-TTTTTTTGTTAGTGT- AtATATTT- 1761; reverse: 1914-TTCTCCCAAACTCCCTCC- 1897). The Intracerebroventricular infusions. Animals were anesthetized and secured in nested PCR product(177 bp)was then subcloned (Original TA cloning kit, a stereotaxic frame, and a stainless-steel guide cannula(22 gauge),8 mm prepped. Ten plasmids containing the ligated exon 1, GR promoter DNA rior to bregma, 2.0 mm lateral to midline, 3.0 mm ventral to the brain surface) Chromatin immunoprecipitation(ChIP) assay. ChIP assays 3 were done micro-syringe)through the infusion cannula over &. Pharmacia Biotech)starting from procedure C in the manufacturer's proto- seven consecutive days as described below. Animals were removed from their col. The sequencing reactions were resolved on a denaturing (6%)PAGE cages and gently held while an infusion cannula(28-gauge)attached to tubing PE 20)was lowered into the guide. A total volume of 2 ul of TSA(100 ng/ml eriod. Infusion using the ChIP assay kit protocol(06-599, Upstate Biotechnology). cannulae were left in place for an additional minute after infusion.Animals Hippocampi were dissected from each rat brain and chromatin was immuno. were then returned to their home cage precipitated using one of the following: rabbit polyclonal antibody to acetyl- 8 histone H3(Upstate Cell Signaling Solutions), rabbit polyclonal antibody to Western blotting. Studies were performed as previously described5.Protein a Biotechnology). One-tenth of the lysate was kept to quantify the amount of Pharmacia Biotech) was incubated with anti-rat GR-a monoclonal primary at hippocampal GR exon 1, promoter region(GenBank accession number peroxidase-conjugated sheep anti-mouse immunoglobulin G antibody AJ271870)of the uncrosslinked DNA was subjected to PCR amplification (1:3,000; Amersham Pharmacia Biotech). A single band was observed at a( forward primer: 1750-TGTGACACACTTCGCGCA-1767, reverse primer: -92 kDa upon exposure to film(Amersham Pharmacia Biotech).To verify the 943-GGAGGGAAACCGAGTTTC-1926) PCR reactions were done with the accuracy of sample loading, selected blots were reprobed with a monoclonal 9 FailSafe PCR system protocol using FailSafe PCR 2x PreMix D(Epicentre, antibody to tubulin(a-tubulin; 1: 5,000: Biodesign International).A single e InterScience). The thermocycler protocol involved an initial denaturation band was observed at -60 k Da and the intensity of the signal was similar in all o cycle(5 min, 95C), 34 cycles of denaturation(1 min, 95C), annealing(I lanes. Relative optical density(ROD)readings for the GR-a and a-tubulin on cycle bands were determined using a computer-assisted densitometry program histone H3-K9 immunoprecipitate, the rat hippocampal B-actin promoter-a triplicate on three different blots. The glucocorticoid receptor ROD value was region( Gen Bank accession number vo1217)of the uncrosslinked DNA was divided by the a-tubulin ROD value cortico subjected to PCR amplification(forward primer: 10-TCAACTCACTTC receptor signal for each sample For all studies, single blots were derived from TCTCTACT-29; reverse primer: 161-GCAAGGCTTTAACGGAAAAT- 180). samples from one animal. (Epicentre, InterScience)with the same thermocycler protocol as previously ers(8.5 X21.5 cm; Kent Scientific)for a 20-min period. Prestress blood sam- mplified the rat hippocampal exon Ib estrogen receptor-a promoter region restraint stress was performed during the light cycle between 12:00 and 15:00 o (Gen Bank accession number X98236)of the uncrosslinked DNA(forward with blood sampling (300 ul)from the tail vein at 10, 20, 40, 60 and 90 min primer:1836-GAAGAAACTCCCCICAGCAT-1855: reverse primer: 2346. after the onset of restraint 2. Plasma (10 ul)corticosterone was measured by Epicentre, InterScience). The thermocycler protocol involved an initial denat radioimmunoassay (RIA) with a highly specific B antiserum (B3-163 uration cycle(5 min, 95C), 34 cycles of denaturation(I min, 95.C), anneal- Endocrine Sciences) and [H]corticosterone(101 Ci/mmol; NEN) tracer. The antiserum cross-reacts slightly with deoxycorticosterone(-4%)but not ing (I min, 60"C)and extension (I min, 72"C), followed by a final extension with aldosterone, cortisol and progesterone(<1%). The intra-assay and from non-immunoprecipitated samples and immunoprecipitated samples standard curve 50% effective concentration was 16 ug/dl, and the detection were repeated exhaustively using varying amounts of template to ensure that limit of the assay was 0.63 ug/dl results were within the linear range of the PCR Products were separated on a 2%6 agarose gel to visualize bands corresponding to the exon 1, GR Promoter Note: Supplementary info is available on the Nature Neuroscience website (194 bp), B-actin promoter-a(171 bp) or exon 1b estrogen receptor-ox pro moter(493 bp) DNA fragments. Nucleic acids were transferred by Southern ACKNOWLEDGMENTS blot (overnight, 22 C)to positively charged nylon transfer membrane These studi Institutes for health (Hybond-N+, Amersham). An oligonucleotide(20 bp)specific for the exon 1, Research(CIHR)to M. J.M. and M.S. and from the GR promoter sequence(GenBank accession number AJ271870; forward: Canada to M.S. M J.M. is supported by a CIHR Se r soient ist award and the 881-TCCCGAGCGGTTCCAAGCCT-1907)was synthesized, as well as an project was supported by a Distinguished Investigat (M. J.M. )from the (GenBank accession number Vo1217; forward: 95-GTAAAAAAATGCTG. (NARSAD ance for Research on Schizophrenia and Affective Disorders oligonucleotide(21 bp) specific for the B-actin promoter-a sequence CACTGTC-115)and an oligonucleotide(20 bp)specific for the exon 1b estro- COMPETING INTERESTS STATEMENT gen receptor-a promoter sequence(GenBank accession number x98236: The authors declare that they have no competing financial interests. rward: 1942-AGAAAGCACTGGACATTICT-1961). The oligonucleotides were radiolabeled(1 ul T4 polynucleotide kinase(PNK), Promega)with 5 ul Received 2 March: accepted 26 May 2004 Y-32p]atp(AmershAm)(2h,37c)andthenhybridizedtothemembranesPublishedonlineathttp://www.nature.com/natureneuroscience/ that were then subjected to autoradiography. Relative optical density(rOD) adings were determined using a computer-assisted densitometry program 1. Agrawal, A.A. Phenotypic plasticity in the interactions and evolution of species. (MCID Systems; Imaging Research). To calculate the final signal for each sam Science294,321-326(2001) NATURE NEUROSCIENCE VOLUME 7 NUMBER 8 AUGUST 2004 853
ARTICLES ATTTCTTTAATTTCTCTTCTCC-1908). The thermocycler protocol involved an initial denaturation cycle (5 min, 95 °C), 34 cycles of denaturation (1 min, 95 °C), annealing (2 min 30 s, 56 °C) and extension (1 min, 72 °C), followed by a final extension cycle (5 min, 72 °C) terminating at 4 °C. The PCR product (285 bp) was used as a template for subsequent PCR reactions using nested primers (forward: 1738-TTTTTTTGTTAGTGTGATATATTT-1761; reverse: 1914-TTCTCCCAAACTCCCTCC-1897). The nested PCR product (177 bp) was then subcloned (Original TA cloning kit, Invitrogen), transformed, and ten different clones per plate were miniprepped. Ten plasmids containing the ligated exon 17 GR promoter DNA fragment were sequenced per animal (T7 sequencing kit, USB, Amersham Pharmacia Biotech) starting from procedure C in the manufacturer’s protocol. The sequencing reactions were resolved on a denaturing (6%) PAGE and visualized by autoradiography. Chromatin immunoprecipitation (ChIP) assay. ChIP assays33 were done using the ChIP assay kit protocol (06-599, Upstate Biotechnology). Hippocampi were dissected from each rat brain and chromatin was immunoprecipitated using one of the following: rabbit polyclonal antibody to acetylhistone H3 (Upstate Cell Signaling Solutions), rabbit polyclonal antibody to NGFI-A or normal rabbit IgG non-immune antibody (both from Santa Cruz Biotechnology). One-tenth of the lysate was kept to quantify the amount of DNA present in different samples before immunoprecipitation (input). The rat hippocampal GR exon 17 promoter region (GenBank accession number AJ271870) of the uncrosslinked DNA was subjected to PCR amplification (forward primer: 1750-TGTGACACACTTCGCGCA-1767; reverse primer: 1943-GGAGGGAAACCGAGTTTC-1926). PCR reactions were done with the FailSafe PCR system protocol using FailSafe PCR 2× PreMix D (Epicentre, InterScience). The thermocycler protocol involved an initial denaturation cycle (5 min, 95 °C), 34 cycles of denaturation (1 min, 95 °C), annealing (1 min, 56 °C) and extension (1 min, 72 °C), followed by a final extension cycle (10 min, 72 °C) terminating at 4 °C. To control for unequal loading of acetylhistone H3-K9 immunoprecipitate, the rat hippocampal β-actin promoter-α region (GenBank accession number V01217) of the uncrosslinked DNA was subjected to PCR amplification (forward primer: 10-TCAACTCACTTC TCTCTACT-29; reverse primer: 161-GCAAGGCTTTAACGGAAAAT-180). PCR reactions were done with the same protocol, but using FailSafe PreMix L (Epicentre, InterScience) with the same thermocycler protocol as previously described. To control for purity of the NGFI-A immunoprecipitate, we PCRamplified the rat hippocampal exon 1b estrogen receptor-α promoter region (GenBank accession number X98236) of the uncrosslinked DNA (forward primer: 1836-GAAGAAACTCCCCTCAGCAT-1855; reverse primer: 2346- GAAATCAAAACACCGATCCT-2327), this time using FailSafe PreMix A (Epicentre, InterScience). The thermocycler protocol involved an initial denaturation cycle (5 min, 95 °C), 34 cycles of denaturation (1 min, 95 °C), annealing (1 min, 60 °C) and extension (1 min, 72 °C), followed by a final extension cycle (10 min, 72 °C) terminating at 4 °C. PCR reactions on DNA purified from non-immunoprecipitated samples and immunoprecipitated samples were repeated exhaustively using varying amounts of template to ensure that results were within the linear range of the PCR. Products were separated on a 2% agarose gel to visualize bands corresponding to the exon 17 GR promoter (194 bp), β-actin promoter-α (171 bp) or exon 1b estrogen receptor-α promoter (493 bp) DNA fragments. Nucleic acids were transferred by Southern blot (overnight, 22 °C) to positively charged nylon transfer membrane (Hybond-N+, Amersham). An oligonucleotide (20 bp) specific for the exon 17 GR promoter sequence (GenBank accession number AJ271870; forward: 1881-TCCCGAGCGGTTCCAAGCCT-1907) was synthesized, as well as an oligonucleotide (21 bp) specific for the β-actin promoter-α sequence (GenBank accession number V01217; forward: 95-GTAAAAAAATGCTGCACTGTC-115) and an oligonucleotide (20 bp) specific for the exon 1b estrogen receptor-α promoter sequence (GenBank accession number X98236; forward: 1942-AGAAAGCACTGGACATTTCT-1961). The oligonucleotides were radiolabeled (1 µl T4 polynucleotide kinase (PNK), Promega) with 5 µl [γ-32P]ATP (Amersham) (2 h, 37 °C) and then hybridized to the membranes that were then subjected to autoradiography. Relative optical density (ROD) readings were determined using a computer-assisted densitometry program (MCID Systems; Imaging Research). To calculate the final signal for each sample, the ROD value of the band within the antibody lane (A) was divided by the ROD value of the band within the input lane (I). To control for equal loading between samples, the final signal of the exon 17 GR promoter, amplified from the acetyl-histone H3-K9 immunoprecipitations, was divided by the final signal from the β-actin promoter-α amplified from the same precipitate. Intracerebroventricular infusions. Animals were anesthetized and secured in a stereotaxic frame, and a stainless-steel guide cannula (22 gauge), 8 mm length (Plastic One Inc.) was aimed at the left lateral ventricle (1.5 mm posterior to bregma, 2.0 mm lateral to midline, 3.0 mm ventral to the brain surface). After a 7-d recovery period, animals received a single infusion every day for seven consecutive days as described below. Animals were removed from their cages and gently held while an infusion cannula (28-gauge) attached to tubing (PE 20) was lowered into the guide. A total volume of 2 µl of TSA (100 ng/ml in DMSO) or DMSO vehicle alone was injected (using a Hamilton 10-ml micro-syringe) through the infusion cannula over a 1-min period. Infusion cannulae were left in place for an additional minute after infusion. Animals were then returned to their home cage. Western blotting. Studies were performed as previously described15. Protein (40 µg, whole cell extract) rendered on nitrocellulose (C+, Amersham Pharmacia Biotech) was incubated with anti-rat GR-α monoclonal primary antibodies in blocking buffer (1:4,000; Affinity BioReagents) and horseradish peroxidase-conjugated sheep anti-mouse immunoglobulin G antibody (1:3,000; Amersham Pharmacia Biotech). A single band was observed at ∼92 kDa upon exposure to film (Amersham Pharmacia Biotech). To verify the accuracy of sample loading, selected blots were reprobed with a monoclonal antibody to tubulin (α-tubulin; 1:5,000; Biodesign International). A single band was observed at ∼60 kDa and the intensity of the signal was similar in all lanes. Relative optical density (ROD) readings for the GR-α and α-tubulin bands were determined using a computer-assisted densitometry program (MCID 4.0; Imaging Research) from samples (n = 6 animals/group) run in triplicate on three different blots. The glucocorticoid receptor ROD value was divided by the α-tubulin ROD value to determine the final glucocorticoid receptor signal for each sample. For all studies, single blots were derived from samples from one animal. HPA response to restraint stress. Animals were placed in Plexiglass restrainers (8.5 × 21.5 cm; Kent Scientific) for a 20-min period. Prestress blood samples were taken from rats within 30 s of removal from the home cage, and restraint stress was performed during the light cycle between 12:00 and 15:00 with blood sampling (300 µl) from the tail vein at 10, 20, 40, 60 and 90 min after the onset of restraint12. Plasma (10 µl) corticosterone was measured by radioimmunoassay (RIA) with a highly specific B antiserum (B3-163; Endocrine Sciences) and [3H]corticosterone (101 Ci/mmol; NEN) tracer. The antiserum cross-reacts slightly with deoxycorticosterone (∼4%) but not with aldosterone, cortisol and progesterone (<1%). The intra-assay and interassay coefficients of variation were 8.8% and 10.4%, respectively. The standard curve 50% effective concentration was 16 µg/dl, and the detection limit of the assay was 0.63 µg/dl. Note: Supplementary information is available on the Nature Neuroscience website. ACKNOWLEDGMENTS These studies were supported by a grant from the Canadian Institutes for Health Research (CIHR) to M.J.M. and M.S. and from the National Cancer Institute of Canada to M.S. M.J.M. is supported by a CIHR Senior Scientist award and the project was supported by a Distinguished Investigator Award (M.J.M.) from the National Alliance for Research on Schizophrenia and Affective Disorders (NARSAD). COMPETING INTERESTS STATEMENT The authors declare that they have no competing financial interests. Received 2 March; accepted 26 May 2004 Published online at http://www.nature.com/natureneuroscience/ 1. Agrawal, A.A. Phenotypic plasticity in the interactions and evolution of species. Science 294, 321–326 (2001). NATURE NEUROSCIENCE VOLUME 7 | NUMBER 8 | AUGUST 2004 853 © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES M.C. Maternal Effects as Adaptations (eds. Fox, T.A. Mousseau, C W) 17. Kadonaga, J T. Eukaryotic transcription: an interlaced network of transcription fac- niversity Press, London, 1999) tors and chromatin-modifying machines. Cell 92, 307-313(1998) cture and gene silencing- a three- way 4. Fleming, A.S., O'Day, D H. Kraemer, G W. Neurobiology of mother-infant interac- 19. Keshet, I, Yisraeli, J.& Cedar, H. Effect of regional DNA methylation on gene s: experience and central nervous system plasticity across development and gen- expression. Proc. Natl. Acad. Sci. USA 82, 2560-2564(1985) erations. Neurosci. Biobehav Rev. 23 673-685(1999 20. Razin.a stribution of 5-methylcytosine in chromatin. Proc. Natl. 5. Meaney, M.J. Maternal care, gene expression, and the transmission of individual Acad.Sci.USA74,2725-2728(1977) ommer, M. High sensitivity mapping of 1161-1192(2001) 6. Stern, J.M. Offspring- induced nurturance: animal-human parallels. Dev. Psychobiol. 22. Frommer, M. et al. A genomic sequencing protocol that yields a positive display of 5- methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA 7. Liu. D. et al. Maternal care. hi mpal glucocorticoid receptors, and hypothala- 23 Cintra, A ef al. Mapping and computer assisted morphometry and microdensitome- 8. Caldji, C. et al. Maternal care during infancy regulates the development of neural try of glucocorticoid receptor im rons and glial cells in the rat cen systems mediating the expression of fearfulness in the rat. Proc. Natl. Acad. Sc tral nervous system. Neuroscience 62, 843-897(1994) 24. Cintra, A. et al. Glial and neuronal glucocorticoid receptor immunoreactive cell pop- 9. Francis, D, Diorio, J, Liu, D& Meaney, M.J. Nongenomic transmission across ternal behavior and stress responses in the rat. Science 286 唱mAs06.4253 25. Brinton, R D, Yamazaki, R, Gonzalez, C.M., O'Neill, K.& Schreiber, S.S. 0. Myers, M. M, Brunelli, S.A., Shair, H N, Squire, J M.& Hofer, M.A. Relationships Vasopressin-induction of the immediate early gene, NGFI-A in cultured hippocam between maternal behavior of SHR and wKY dams and adult blood pressures of 810kPpu0P251671989 imprinting of genes. Sci. Am. 263, 52-6 alance in health and disease. Endocr. Rev. 19, 269-301(199 relevance to expression during mouse develop 12. Meaney, M.J., Aitken, D.H., Viau, V, Sharma, s& Sarrieau, A. Neonatal handling 28 Meaney, M.J. et al. Early environmental regulation of forebrain glucocorticoid recep- alters adrenocortical negative feedback sensitivity and hippocampal type ll gluco- tor gene expression: implications for adrenocortical responses to stress. Dev rat neuro Neurosci.18,49-7201996) 3. Weaver, l.C. et al. Early environmental regulation of hippocampal glucocorticoid 29. Roth, S Y, Denu, J M.& Allis, C D Histone acetyltransferases. Annu. Rev. Biochem. receptor gene expression: characterization of intracellular mediators and potential 70,81-120(2001) s Genomic target sites. Mol Cell. Endocrinol. 185, 205-218(2001) 30 Cervoni, N. Szyf, M. Demethylase activity is directed by histone acetylation serotonin.J.Neurosci.20,39 A)dling increases the expression of cAMP-inducible J.Biol.chem.276,4077840787(2001 ippocampus: the effects of thyroid hormones and 31. M J. A nerve uced gene encodes a possible transcriptional 5. Laplante, P, Diorio, J& Meaney, M.J. Serotonin regulates hippocampal glucocorti- 32. Champagne, F-A, Francis, DD, Mar, A& Meaney, M.J. Variations in maternal care coid receptor expression via a 5-HT7 receptor. Brain Res. Dev. Brain Res. 139 in the rat as a mediating influence for the effects of environment on development. C, Myers, FA, Hebbes, T.R., Clayton, A L.& Thorne, A w oprecipitation assays in acetylation mapping of higher eukaryotes Methods Enzymo.304,533-547(1999) 854 VOLUME 7 NUMBER 8 AUGUST 2004 NATURE NEUROSCIENCE
ARTICLES 2. Rossiter, M.C. Maternal Effects as Adaptations (eds. Fox, T.A. & Mousseau, C.W.) (Oxford University Press, London, 1999). 3. Levine, S. The ontogeny of the hypothalamic-pituitary-adrenal axis. The influence of maternal factors. Ann. NY Acad. Sci. 746, 275–293 (1994). 4. Fleming, A.S., O’Day, D.H. & Kraemer, G.W. Neurobiology of mother-infant interactions: experience and central nervous system plasticity across development and generations. Neurosci. Biobehav. Rev. 23, 673–685 (1999). 5. Meaney, M.J. Maternal care, gene expression, and the transmission of individual differences in stress reactivity across generations. Annu. Rev. Neurosci. 24, 1161–1192 (2001). 6. Stern, J.M. Offspring-induced nurturance: animal-human parallels. Dev. Psychobiol. 31, 19–37 (1997). 7. Liu, D. et al. Maternal care, hippocampal glucocorticoid receptors, and hypothalamic-pituitary-adrenal responses to stress. Science 277, 1659–1662 (1997). 8. Caldji, C. et al. Maternal care during infancy regulates the development of neural systems mediating the expression of fearfulness in the rat. Proc. Natl. Acad. Sci. USA 95, 5335–5340 (1998). 9. Francis, D., Diorio, J., Liu, D. & Meaney, M.J. Nongenomic transmission across generations of maternal behavior and stress responses in the rat. Science 286, 1155–1158 (1999). 10. Myers, M.M., Brunelli, S.A., Shair, H.N., Squire, J.M. & Hofer, M.A. Relationships between maternal behavior of SHR and WKY dams and adult blood pressures of cross-fostered F1 pups. Dev. Psychobiol. 22, 55–67 (1989). 11. De Kloet, E.R., Vreugdenhil, E., Oitzl, M.S. & Joels, M. Brain corticosteroid receptor balance in health and disease. Endocr. Rev. 19, 269–301 (1998). 12. Meaney, M.J., Aitken, D.H., Viau, V., Sharma, S. & Sarrieau, A. Neonatal handling alters adrenocortical negative feedback sensitivity and hippocampal type II glucocorticoid receptor binding in the rat. Neuroendocrinology 50, 597–604 (1989). 13. Weaver, I.C. et al. Early environmental regulation of hippocampal glucocorticoid receptor gene expression: characterization of intracellular mediators and potential genomic target sites. Mol. Cell. Endocrinol. 185, 205–218 (2001). 14. Meaney, M.J. et al. Postnatal handling increases the expression of cAMP-inducible transcription factors in the rat hippocampus: the effects of thyroid hormones and serotonin. J. Neurosci. 20, 3926–3935 (2000). 15. Laplante, P., Diorio, J. & Meaney, M.J. Serotonin regulates hippocampal glucocorticoid receptor expression via a 5-HT7 receptor. Brain Res. Dev. Brain Res. 139, 199–203 (2002). 16. McCormick, J.A. et al. 5′-heterogeneity of glucocorticoid receptor messenger RNA is tissue specific: differential regulation of variant transcripts by early-life events. Mol. Endocrinol. 14, 506–517 (2000). 17. Kadonaga, J.T. Eukaryotic transcription: an interlaced network of transcription factors and chromatin-modifying machines. Cell 92, 307–313 (1998). 18. Razin, A. CpG methylation, chromatin structure and gene silencing- a three-way connection. Embo J. 17, 4905–4908 (1998). 19. Keshet, I., Yisraeli, J. & Cedar, H. Effect of regional DNA methylation on gene expression. Proc. Natl. Acad. Sci. USA 82, 2560–2564 (1985). 20. Razin, A. & Cedar, H. Distribution of 5-methylcytosine in chromatin. Proc. Natl. Acad. Sci. USA 74, 2725–2728 (1977). 21. Clark, S.J., Harrison, J., Paul, C.L. & Frommer, M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 22, 2990–2997 (1994). 22. Frommer, M. et al. A genomic sequencing protocol that yields a positive display of 5- methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA 89, 1827–1831 (1992). 23. Cintra, A. et al. Mapping and computer assisted morphometry and microdensitometry of glucocorticoid receptor immunoreactive neurons and glial cells in the rat central nervous system. Neuroscience 62, 843–897 (1994). 24. Cintra, A. et al. Glial and neuronal glucocorticoid receptor immunoreactive cell populations in developing, adult, and aging brain. Ann. NY Acad. Sci. 746, 42–63 (1994). 25. Brinton, R.D., Yamazaki, R., Gonzalez, C.M., O’Neill, K. & Schreiber, S.S. Vasopressin-induction of the immediate early gene, NGFI-A, in cultured hippocampal glial cells. Brain Res. Mol. Brain Res. 57, 73–85 (1998). 26. Sapienza, C. Parental imprinting of genes. Sci. Am. 263, 52–60 (1990). 27. Hershko, A.Y., Kafri, T., Fainsod, A. & Razin, A. Methylation of HoxA5 and HoxB5 and its relevance to expression during mouse development. Gene 302, 65–72 (2003). 28. Meaney, M.J. et al. Early environmental regulation of forebrain glucocorticoid receptor gene expression: implications for adrenocortical responses to stress. Dev. Neurosci. 18, 49–72 (1996). 29. Roth, S.Y., Denu, J.M. & Allis, C.D. Histone acetyltransferases. Annu. Rev. Biochem. 70, 81–120 (2001). 30. Cervoni, N. & Szyf, M. Demethylase activity is directed by histone acetylation. J. Biol. Chem. 276, 40778–40787 (2001). 31. Milbrandt, J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 238, 797–799 (1987). 32. Champagne, F.A., Francis, D.D., Mar, A. & Meaney, M.J. Variations in maternal care in the rat as a mediating influence for the effects of environment on development. Physiol. Behav. 79, 359–371 (2003). 33. Crane-Robinson, C., Myers, F.A., Hebbes, T.R., Clayton, A.L. & Thorne, A.W. Chromatin immunoprecipitation assays in acetylation mapping of higher eukaryotes. Methods Enzymol. 304, 533–547 (1999). 854 VOLUME 7 | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE © 2004 Nature Publishing Group http://www.nature.com/natureneuroscience
