XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 535 Table 1 Nucleotide sequences of primers used in polymerase chain reaction Primer Direction Sequence(5'→3) BrcERFB3-1 F ATGCAATATCTCTACACCAG for ORF cloning BrcERFB3-1 R CTGAAACAATTCAGACATAGTG for ORF cloning BrcERFB3-2 F GGTTGTCTGCTGCGACTATTGGT for qRT-PCR BrcERFB3-2 ATCTTCCCGGGTTCCGCAAACTT for qRT-PCR actin F CTCAGTCCAAAAGAGGTATTCT for gRT-PCR actin R GTAGAATGTGTGATGCCAGATC for gRT-PCR 5.5.RT-PCR assays of BrcERF-B3 gene Hall B G.2013.Building phylogenetic trees from molecular data with MEGA.Molecular Biology and Evolution,30. RT-PCR was carried out with different flower organs in two 1229-1235. lines.Actin gene was used as an internal reference.The Hands P,Vosnakis N,Betts D,Irish VF,Drea S.2011.Altemnate BrcERF-B3 expression analysis was conducted and the transcripts of a floral developmental regulator have both amplification conditions were as follows,94C for 5 min;and distinct and redundant functions in opium poppy.Annals of Botany,.107,1557-1566. 28 cycles of94°Cfor30s,58°Cfor30s;72°Cfor30s;and Huang F,Xu GL,Chi Y J,Liu HC,Xue Q,Zhao T J,Gai JY, finally 10 min at 72C.The PCR products were detected Yu D Y.2014.A soybean MADS-box protein modulates by 1.2%agarose gel electrophoresis and visualized with floral organ numbers,petal identity and sterility.BMC Plant ethidium bromide under UV light. Biology,14,89 Ito T,Ng K H.Lim T S.Yu H,Meyerowitz E M.2007.The 5.6.Data analysis homeotic protein AGAMOUS controls late stamen development by regulating a jasmonate biosynthetic gene The amino acid sequences were carried out with the BLAST in Arabidopsis.The Plant Cell,19,3516-3529. program of Plant Transcription Factor Database(PlantTFDB. Kizis D,Lumbreras V,Pages M.2001.Role of AP2/EREBP http://planttfdb.cbi.pku.edu.cn/),the Clustal W program transcription factors in gene regulation during abiotic stress. FEBS Letters,498.187-189 package (http://www.ebi.ac.uk/clustalw/).The related se- Li MY,Wang F,Jiang Q,Ma J.Xiong AS.2013.Genome-wide quence alignment report was analyzed with DNAMAN6.0 analysis of the distribution of AP2/ERF transcription factors (http://ishare.iask.sina.com.cn/f/34031431.html).The reveals duplication and elucidates their potential function molecular phylogenetic analyses among the different ERF in Chinese cabbage(Brassica rapa ssp.pekinensis).Plant genes of Arabidopsis and different plants were conducted Molecular Biology Reporter,31,1002-1011. using MEGA 5(Hall 2013)with the neighbor-joining (NJ) McGrath K C,Dombrecht B,Manners J M,Schenk P M, method.The bootstrap value was set at 1000 replications Edgar C I,Maclean D J.Scheible W R,Udvardi M K. to assess tree reliability.The gRT-PCR results were calcu- Kazan K.2005.Repressor-and activator-type ethylene lated by the 2-AC method,where C.was the cycle threshold response factors functioning in jasmonate signaling and (Pfaffl 2001). disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression.Plant Acknowledgements Physiology,139,949-959. Nakano T,Fujisawa M,Shima Y,Ito Y.2014.The AP2/ERF transcription factor SIERF52 functions in flower pedicel This work was supported by the Independent Innovation abscission in tomato.Journal of Experimental Botany,65, Fund for Agricultural Science and Technology of Jiangsu 3111-3119. Province,China(CX(15)1015). Nakano T,Suzuki K,Fujimura T,Shinshi H.2006.Genome- wide analysis of the ERF gene family in Arabidopsis and References rice.Plant Physiology,140,411-432. Ohme-Takagi M,Shinshi H.1995.Ethylene-inducible DNA Champion A,Hebrard E,Parra B,Boumnaud C,Marmey P, binding proteins that interact with an ethylene-responsive Tranchant C,Nicole M.2009.Molecular diversity and gene element.The Plant Cell,7,173-182. expression of cotton ERF transcription factors reveal that Pak H,Guo Y,Chen MX,Chen K M,Li Y L,Hua S J,Shamsi group IXa members are responsive to jasmonate,ethylene I,Meng H B,Shi C G.Jiang L X.2009.The effect of and Xanthomonas.Molecular Plant Pathology,10,471-485. exogenous methyl jasmonate on the flowering time,floral Gutterson N,Reuber T L.2004.Regulation of disease organ morphology and transcript levels of a group of genes resistance pathways by AP2/ERF transcription factors. implicated in the development of oilseed rape flowers Current Opinion in Plant Biology,7,465-471. (Brassica napus L.).Planta,231,79-91.XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 535 5.5. RT-PCR assays of BrcERF-B3 gene RT-PCR was carried out with different flower organs in two lines. Actin gene was used as an internal reference. The BrcERF-B3 expression analysis was conducted and the amplification conditions were as follows, 94°C for 5 min; and 28 cycles of 94°C for 30 s, 58°C for 30 s; 72°C for 30 s; and finally 10 min at 72°C. The PCR products were detected by 1.2% agarose gel electrophoresis and visualized with ethidium bromide under UV light. 5.6. Data analysis The amino acid sequences were carried out with the BLAST program of Plant Transcription Factor Database (PlantTFDB, http://planttfdb.cbi.pku.edu.cn/), the Clustal W program package (http://www.ebi.ac.uk/clustalw/). The related se￾quence alignment report was analyzed with DNAMAN6.0 (http://ishare.iask.sina.com.cn/f/34031431.html). The molecular phylogenetic analyses among the different ERF genes of Arabidopsis and different plants were conducted using MEGA 5 (Hall 2013) with the neighbor-joining (NJ) method. The bootstrap value was set at 1000 replications to assess tree reliability. The qRT-PCR results were calcu￾lated by the 2–ΔΔCT method, where CT was the cycle threshold (Pfaffl 2001). Acknowledgements This work was supported by the Independent Innovation Fund for Agricultural Science and Technology of Jiangsu Province, China (CX(15)1015). References Champion A, Hebrard E, Parra B, Bournaud C, Marmey P, Tranchant C, Nicole M. 2009. Molecular diversity and gene expression of cotton ERF transcription factors reveal that group IXa members are responsive to jasmonate, ethylene and Xanthomonas. Molecular Plant Pathology, 10, 471–485. Gutterson N, Reuber T L. 2004. Regulation of disease resistance pathways by AP2/ERF transcription factors. Current Opinion in Plant Biology, 7, 465–471. Hall B G. 2013. Building phylogenetic trees from molecular data with MEGA. Molecular Biology and Evolution, 30, 1229–1235. Hands P, Vosnakis N, Betts D, Irish V F, Drea S. 2011. Alternate transcripts of a floral developmental regulator have both distinct and redundant functions in opium poppy. Annals of Botany, 107, 1557–1566. Huang F, Xu G L, Chi Y J, Liu H C, Xue Q, Zhao T J, Gai J Y, Yu D Y. 2014. A soybean MADS-box protein modulates floral organ numbers, petal identity and sterility. BMC Plant Biology, 14, 89. Ito T, Ng K H, Lim T S, Yu H, Meyerowitz E M. 2007. The homeotic protein AGAMOUS controls late stamen development by regulating a jasmonate biosynthetic gene in Arabidopsis. The Plant Cell, 19, 3516–3529. Kizis D, Lumbreras V, Pagès M. 2001. Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Letters, 498, 187–189. Li M Y, Wang F, Jiang Q, Ma J, Xiong A S. 2013. Genome-wide analysis of the distribution of AP2/ERF transcription factors reveals duplication and elucidates their potential function in Chinese cabbage (Brassica rapa ssp. pekinensis). Plant Molecular Biology Reporter, 31, 1002–1011. McGrath K C, Dombrecht B, Manners J M, Schenk P M, Edgar C I, Maclean D J, Scheible W R, Udvardi M K, Kazan K. 2005. Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression. Plant Physiology, 139, 949–959. Nakano T, Fujisawa M, Shima Y, Ito Y. 2014. The AP2/ERF transcription factor SlERF52 functions in flower pedicel abscission in tomato. Journal of Experimental Botany, 65, 3111–3119. Nakano T, Suzuki K, Fujimura T, Shinshi H. 2006. Genome￾wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiology, 140, 411–432. Ohme-Takagi M, Shinshi H. 1995. Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. The Plant Cell, 7, 173–182. Pak H, Guo Y, Chen M X, Chen K M, Li Y L, Hua S J, Shamsi I, Meng H B, Shi C G, Jiang L X. 2009. The effect of exogenous methyl jasmonate on the flowering time, floral organ morphology and transcript levels of a group of genes implicated in the development of oilseed rape flowers (Brassica napus L.). Planta, 231, 79–91. Table 1 Nucleotide sequences of primers used in polymerase chain reaction Primer Direction Sequence (5´→3´) BrcERFB3-1 F ATGCAATATCTCTACACCAG for ORF cloning BrcERFB3-1 R CTGAAACAATTCAGACATAGTG for ORF cloning BrcERFB3-2 F GGTTGTCTGCTGCGACTATTGGT for qRT-PCR BrcERFB3-2 R ATCTTCCCGGGTTCCGCAAACTT for qRT-PCR actin F CTCAGTCCAAAAGAGGTATTCT for qRT-PCR actin R GTAGAATGTGTGATGCCAGATC for qRT-PCR