《园艺作物育种学》课程教学资源（学术研究）Isolation and characterization of an ERF-B3 gene associated with flower abnormalities in non-heading Chinese cabbage

Journal of Integrative Agriculture 2016,15(3):528-536 Available online at www.sciencedirect.com A ScienceDirect ELSEVIER RESEARCH ARTICLE Isolation and characterization of an ERF-B3 gene associated with flower abnormalities in non-heading Chinese cabbage Cross Marl XU Yu-chao',HOU Xi-lin',XU Wei-wei',SHEN Lu-lu2,LU Shan-wu',ZHANG Shi-lin',HU Chun-mei' State Key Laboratory of Crop Genetics and Germplasm Enhancement,Ministry of Science and Technology/College of Horticulture,Nanjing Agricultural University,Nanjing 210095.P.R.China Agriculture Committee of Feixi County,Hefei 230001,P.R.China Abstract BrcERF-B3 gene,a member of ethylene-responsive factor family,was screened from a mutant plant in non-heading Chinese cabbage(Brassica rapa ssp.chinensis)by cDNA-AFLP technology.We got full length cDNA of two BrcERF-B3 genes by homology-based cloning from two materials and found that their nucleotide sequences were the same by sequencing.The BrcERF-B3 protein,belonging to the B3 subgroup of the ERF subfamily,shared a close relationship with B.rapa.RT-PCR result showed that BrcERF-B3 expressed only in mutant stamen rather than maintainer stamen.gRT-PCR results indicated that BrcERF-B3 expressed highly during reproductive growth development and in the early of mutant buds,suggesting BrcERF-B3 might be involved in the formation of abnormal flower in mutant.What's more,the expression of BrcERF-B3 was more significant to ABA,MeJA and cold stresses in mutant than in maintainer and was down-regulated in NaCI treatment in two lines,implying BrcERF-B3 might be different roles in biotic and abiotic stresses. Keywords:non-heading Chinese cabbage,stamen-petalody,ethylene-responsive factor,gene expression Plant flower architecture was controlled by some key players (such as transcription factors),some other reports showed 1.Introduction that homeotic conversion of stamens into petaloid structures in the basal Endicott Eschscholzia californica occurred Controlling the fertility was an important goal in crop hy- due to the knocking down of EScaAG1 and 2(Yellina et al. brid breeding.but it was difficult in some crops including 2010).The third and fourth whorls in androecium and non-heading Chinese cabbage.Most of phenotype of gynoecium had a homeotic transformation because of the male sterile lines(CMS or GMS)was instable,whereas the down-regulation of both PapsAG homologs concurrently stamen-dismissing material which was caused by stamen homologous transformation had a relatively stable sterility. (Hands et al.2011). AP2/ERF transcription factor,one of the largest plant transcription factor families,played a crucial role in plant growing and in response to biotic and abiotic stresses Received 12 January,2015 Accepted 8 October,2015 (Riechmannn et al.2000;Sakuma et a/.2002;Zhuang XU Yu-chao,E-mail:1049205908@qq.com; Correspondence HU Chun-mei,Tel:+86-25-84395756 et al.2008).The AP2/ERF superfamily was defined by the E-mail:jjjhcm@njau.edu.cn AP2/ERF domain,which consists about 60-70 amino acids 2016,CAAS.Published by Elsevier Ltd.This is an open and involved in DNA binding (Nakano et al.2006).Based access article under the CC BY-NC-ND license (http:/ on differences in the binding domain sequences,the AP2/ creativecommons.org/licenses/by-nc-nd/4.0/). doi10.1016/S2095-3119(15)61203-5

Journal of Integrative Agriculture 2016, 15(3): 528–536 RESEARCH ARTICLE Available online at www.sciencedirect.com ScienceDirect Isolation and characterization of an ERF-B3 gene associated with flower abnormalities in non-heading Chinese cabbage XU Yu-chao1 , HOU Xi-lin1 , XU Wei-wei1 , SHEN Lu-lu2 , LÜ Shan-wu1 , ZHANG Shi-lin1 , HU Chun-mei1 1 State Key Laboratory of Crop Genetics and Germplasm Enhancement, Ministry of Science and Technology/College of Horticulture, Nanjing Agricultural University, Nanjing 210095, P.R.China 2 Agriculture Committee of Feixi County, Hefei 230001, P.R.China Abstract BrcERF-B3 gene, a member of ethylene-responsive factor family, was screened from a mutant plant in non-heading Chinese cabbage (Brassica rapa ssp. chinensis) by cDNA-AFLP technology. We got full length cDNA of two BrcERF-B3 genes by homology-based cloning from two materials and found that their nucleotide sequences were the same by sequencing. The BrcERF-B3 protein, belonging to the B3 subgroup of the ERF subfamily, shared a close relationship with B. rapa. RT-PCR result showed that BrcERF-B3 expressed only in mutant stamen rather than maintainer stamen. qRT-PCR results indicated that BrcERF-B3 expressed highly during reproductive growth development and in the early of mutant buds, suggesting BrcERF-B3 might be involved in the formation of abnormal flower in mutant. What’s more, the expression of BrcERF-B3 was more significant to ABA, MeJA and cold stresses in mutant than in maintainer and was down-regulated in NaCl treatment in two lines, implying BrcERF-B3 might be different roles in biotic and abiotic stresses. Keywords: non-heading Chinese cabbage, stamen-petalody, ethylene-responsive factor, gene expression Plant flower architecture was controlled by some key players (such as transcription factors), some other reports showed that homeotic conversion of stamens into petaloid structures in the basal Endicott Eschscholzia californica occurred due to the knocking down of EScaAG1 and 2 (Yellina et al. 2010). The third and fourth whorls in androecium and gynoecium had a homeotic transformation because of the down-regulation of both PapsAG homologs concurrently (Hands et al. 2011). AP2/ERF transcription factor, one of the largest plant transcription factor families, played a crucial role in plant growing and in response to biotic and abiotic stresses (Riechmannn et al. 2000; Sakuma et al. 2002; Zhuang et al. 2008). The AP2/ERF superfamily was defined by the AP2/ERF domain, which consists about 60–70 amino acids and involved in DNA binding (Nakano et al. 2006). Based on differences in the binding domain sequences, the AP2/ Received 12 January, 2015 Accepted 8 October, 2015 XU Yu-chao, E-mail: 1049205908@qq.com; Correspondence HU Chun-mei, Tel: +86-25-84395756, E-mail: jjjhcm@njau.edu.cn doi: 10.1016/S2095-3119(15)61203-5 1. Introduction Controlling the fertility was an important goal in crop hy￾brid breeding, but it was difficult in some crops including non-heading Chinese cabbage. Most of phenotype of male sterile lines (CMS or GMS) was instable, whereas the stamen-dismissing material which was caused by stamen homologous transformation had a relatively stable sterility. © 2016, CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/)

XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 529 ERF superfamily can be grouped into five main subfamilies. 2.Results AP2,CBF/DREB,ERF,RAV and one soloist,At4g13040 (Sakuma et al.2002;Nakano et al.2006).They played a 2.1.Cloning the BrcERF-B3 cDNAs from cabbage different role in the regulation of the plant.and there was a mutual regulation relation among them (Zhao et al.2006). The BrcERF-B3 genes were cloned from two different cab- Ethylene-responsive transcription factors (ERFs)were bage lines (Fig.1),and both of their open reading frame firstly identified from tobacco as GCC box-binding proteins (ORF)fragments were 807 bp in length.The sequencing and could either induce or repress the expression of genes results showed that nucleotide sequences of two BrcERF-B3 containing the GCC box and related elements in their pro genes were identical. moters.Sequence analysis showed that ERFs contained a Based on the similarity of the amino acid sequences highly conserved,plant specific DNA-binding domain(DBD) of their DNA-binding domains(DBD),a phylogenetic tree consisting of 58-59 amino acids (Ohme-Takagi and Shinshi was created from the deduced amino acid sequences of 1995).At present,the percentage of total ERFgenes in all BrcERF-B3 and other ERF proteins from Arabidopsis.The the AP2/ERF family has been reported in several plants, result revealed that BrcERF-B3 belonged to the B3 group such as Arabidopsis(44.2%),populus trichocarpa(45.5%). of the ERF subfamily(Figs.2 and 3).The alignment of the Chinese cabbage (45.7%).Vitis vinifera(55%)and rice ERF-B3 showed that DBD of BrcERF-B3 shared a high (48.2%)(Sakuma et al.2002:Nakano et al.2006;Zhuang degree of sequence homology with ERF-B3 from other et al.2008.2009:Li et al.2013).Based on the sequence species.The DBD of BrcERF-B3 consisted of 3 anti-par- identities of their DBD,the ERF subfamily members can be allel B-sheet and 1 a-helix,besides,the F(phenylalanine) classified into six small subgroups(B1 through B6)(Sakuma in BrERF-B3 was replaced by T(threonine)in BrcERF-B3. etal.2002). N(asparagine)in BnERF-B3 was replaced by D(aspartic ERF family genes were reported mostly in responses to acid)in BrcERF-B3,respectively,these residues appeared biotic and abiotic stresses (Gutterson and Reuber 2004: to be responsible for binding specificity(Fig.4).BrcERF-B3 Kizis et al.2001).The group IX ERF genes in cotton may exhibited much greater similarity(95%)to those of BrERF- be involved in jasmonate (JA),ethylene (ET)responses B3(Fig.5). (Champion et al.2009).Arabidopsis ERF family mem- bers B3 subgroup AtERF98 regulated ABA synthesis and 2.2.Analysis of the expression of BrcERF-B3 gene involved in salt stress(Zhang et al.2012).It is reported that AtERF13 and AtERF15 regulate ABA response pos- BrcERF-B3 was completed at different leaf development itively (McGrath et al.2005),however,few researches stages by qRT-PCR.The gene expression profile presented associated with flower development have been found. in Fig.6 showed BrcERF-B3 notably increased during Ro- Non-heading Chinese cabbage(Brassica rapa ssp.chin- sette stage,then significantly decreased in maintainer line, ensis)is a cross-pollinated crop that is widely cultivated in East Asia.We created a stamen-petalody mutant line through chemical mutagenesis,in which stamens convert- ed into petaloid and flower turning into unisexual female flower.We previously obtained an ERF gene fragment by cDNA-AFLP technique,and it was named as BrcERF-B3 bp (not logged).However,the transcriptional regulatory 2000 function of BrcERF-B3 and its expression levels remains 1000 BrcERF-B3 unclear.In this study,we cloned the BrcERF-B3 gene 500 from the leaves and analyzed the expression levels of BrcERF-B3 in different organs in two lines.In addition, 250 we also analyzed the effects of BrcERF-B3 responses to 100 biotic and abiotic stresses.These results indicated that the expression level of BrcERF-B3 expressed only in mutant stamen at the early bud stage.The BrcERF-B3 existed different expression profiles in response to plant hormone, cold and NaCl treatments.These works will provide theoretical base for further studying stamen-petalody in Fig.1 The open reading frame of BrcERF-B3 amplification non-heading Chinese cabbage. products.M.DL2000 marker;1,mutant;2,maintainer

XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 529 ERF superfamily can be grouped into five main subfamilies, AP2, CBF/DREB, ERF, RAV and one soloist, At4g13040 (Sakuma et al. 2002; Nakano et al. 2006). They played a different role in the regulation of the plant, and there was a mutual regulation relation among them (Zhao et al. 2006). Ethylene-responsive transcription factors (ERFs) were firstly identified from tobacco as GCC box-binding proteins and could either induce or repress the expression of genes containing the GCC box and related elements in their pro￾moters. Sequence analysis showed that ERFs contained a highly conserved, plant specific DNA-binding domain (DBD) consisting of 58–59 amino acids (Ohme-Takagi and Shinshi 1995). At present, the percentage of total ERF genes in all the AP2/ERF family has been reported in several plants, such as Arabidopsis (44.2%), populus trichocarpa (45.5%), Chinese cabbage (45.7%), Vitis vinifera (55%) and rice (48.2%) (Sakuma et al. 2002; Nakano et al. 2006; Zhuang et al. 2008, 2009; Li et al. 2013). Based on the sequence identities of their DBD, the ERF subfamily members can be classified into six small subgroups (B1 through B6) (Sakuma et al. 2002). ERF family genes were reported mostly in responses to biotic and abiotic stresses (Gutterson and Reuber 2004; Kizis et al. 2001). The group IX ERF genes in cotton may be involved in jasmonate (JA), ethylene (ET) responses (Champion et al. 2009). Arabidopsis ERF family mem￾bers B3 subgroup AtERF98 regulated ABA synthesis and involved in salt stress (Zhang et al. 2012). It is reported that AtERF13 and AtERF15 regulate ABA response pos￾itively (McGrath et al. 2005), however, few researches associated with flower development have been found. Non-heading Chinese cabbage (Brassica rapa ssp. chin￾ensis) is a cross-pollinated crop that is widely cultivated in East Asia. We created a stamen-petalody mutant line through chemical mutagenesis, in which stamens convert￾ed into petaloid and flower turning into unisexual female flower. We previously obtained an ERF gene fragment by cDNA-AFLP technique, and it was named as BrcERF-B3 (not logged). However, the transcriptional regulatory function of BrcERF-B3 and its expression levels remains unclear. In this study, we cloned the BrcERF-B3 gene from the leaves and analyzed the expression levels of BrcERF-B3 in different organs in two lines. In addition, we also analyzed the effects of BrcERF-B3 responses to biotic and abiotic stresses. These results indicated that the expression level of BrcERF-B3 expressed only in mutant stamen at the early bud stage. The BrcERF-B3 existed different expression profiles in response to plant hormone, cold and NaCl treatments. These works will provide theoretical base for further studying stamen-petalody in non-heading Chinese cabbage. 2. Results 2.1. Cloning the BrcERF-B3 cDNAs from cabbage The BrcERF-B3 genes were cloned from two different cab￾bage lines (Fig. 1), and both of their open reading frame (ORF) fragments were 807 bp in length. The sequencing results showed that nucleotide sequences of two BrcERF-B3 genes were identical. Based on the similarity of the amino acid sequences of their DNA-binding domains (DBD), a phylogenetic tree was created from the deduced amino acid sequences of BrcERF-B3 and other ERF proteins from Arabidopsis. The result revealed that BrcERF-B3 belonged to the B3 group of the ERF subfamily (Figs. 2 and 3). The alignment of the ERF-B3 showed that DBD of BrcERF-B3 shared a high degree of sequence homology with ERF-B3 from other species. The DBD of BrcERF-B3 consisted of 3 anti-par￾allel β-sheet and 1 α-helix, besides, the F (phenylalanine) in BrERF-B3 was replaced by T (threonine) in BrcERF-B3, N (asparagine) in BnERF-B3 was replaced by D (aspartic acid) in BrcERF-B3, respectively, these residues appeared to be responsible for binding specificity (Fig. 4). BrcERF-B3 exhibited much greater similarity (95%) to those of BrERF￾B3 (Fig. 5). 2.2. Analysis of the expression of BrcERF-B3 gene BrcERF-B3 was completed at different leaf development stages by qRT-PCR. The gene expression profile presented in Fig. 6 showed BrcERF-B3 notably increased during Ro￾sette stage, then significantly decreased in maintainer line, M bp 2 000 1000 750 500 250 100 1 2 BrcERF-B3 Fig. 1 The open reading frame of BrcERF-B3 amplification products. M, DL2000 marker; 1, mutant; 2, maintainer

530 XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 AtCBF1 91 AtCBF2 99 AtCBF3 AtDREB-A1 92 DREB AtDREB-A4 AtDREB-A5 AtDREB-A3 52 AtDREB-A2 AtDREB-A6 BrcERF-B3 99 AtERF1 AtERF2 99 AtERF5 AtERF6 ERF 99 AtERF3 68 AtERF7 AtERF9 84 99 AtERF4 AtERF8 AtAP2 AP2 100 AtRAV1 RAV AtRAV2 Fig.2 The phylogenetic analysis between BrcERF-B3 and the Arabidopsis thaliana AP2/ERF superfamily transcription factors. The phylogenetic tree was produced with the neighbor-joining method by the MEGA 5 software.The numbers above the branches indicated the reliability percent of bootstrap values from 1 000 replicates.BrcERF-B3 was boxed.The same as below. while the expression of BrcERF-B3 in mutant firstly subtly 2.3.Investigating the responses of BrcERF-B3 on decreased at rosette stage,then significantly increased,and different stresses keep a higher levels,suggested that BrcERF-B3 enhanced reproductive growth development.The expression profile of After ABA and MeJA treatments,similar trend were found BrcERF-B3 gene showed unobvious expression difference in expression of BrcERF-B3 in mutant and BrcERF-B3 was during flower development stages in maintainer line,but up-regulated and then down-regulated as time goes on.In the gene expressed significantly higher in mutant than in maintainer,the expression of BrcERF-B3 was decreased maintainer at the flower development(bud diameter <2 mm) compared to 0 h excepting at 1 h MeJA treatment.The stages indicated that BrcERF-B3 might enhance abnormal expression of BrcERF-B3 existed significant difference flower development in mutant(Fig.7). between maintainer line and mutant under ABA treatment RT-PCR was carried out on cDNA derived from floral and at 1,2,and 12 h MeJA treatment.During the cold organs to learn more about the BrcERF-B3 expression treatment,BrcERF-B3 gene initially increased at 1 h and profile.The results showed that BrcERF-B3 expressed subsequently slowly reached peaks at the transcription strongly in petal,stamen and carpal in mutant and slightly level at 4 and 2 h in mutant and maintainer,respectively. expressed in sepal,petal and carpel in maintainer.Partic- then decreased slowly.The expression of the gene in ularly.BrcERF-B3 expressed obviously higher in mutant mutant was significantly higher than in maintainer at 2-12 h. stamen than in maintainer stamen,which meant that The transcription levels of BrcERF-B3 in mutant and BrcERF-B3 gene acted a positive role in the formation of maintainer was obviously down-regulated in the NaCl mutant stamen (Fig.8). treatment (Fig.9)

530 XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 while the expression of BrcERF-B3 in mutant firstly subtly decreased at rosette stage, then significantly increased, and keep a higher levels, suggested that BrcERF-B3 enhanced reproductive growth development. The expression profile of BrcERF-B3 gene showed unobvious expression difference during flower development stages in maintainer line, but the gene expressed significantly higher in mutant than in maintainer at the flower development (bud diameter <2 mm) stages indicated that BrcERF-B3 might enhance abnormal flower development in mutant (Fig. 7). RT-PCR was carried out on cDNA derived from floral organs to learn more about the BrcERF-B3 expression profile. The results showed that BrcERF-B3 expressed strongly in petal, stamen and carpal in mutant and slightly expressed in sepal, petal and carpel in maintainer. Partic￾ularly, BrcERF-B3 expressed obviously higher in mutant stamen than in maintainer stamen, which meant that BrcERF-B3 gene acted a positive role in the formation of mutant stamen (Fig. 8). 2.3. Investigating the responses of BrcERF-B3 on different stresses After ABA and MeJA treatments, similar trend were found in expression of BrcERF-B3 in mutant and BrcERF-B3 was up-regulated and then down-regulated as time goes on. In maintainer, the expression of BrcERF-B3 was decreased compared to 0 h excepting at 1 h MeJA treatment. The expression of BrcERF-B3 existed significant difference between maintainer line and mutant under ABA treatment and at 1, 2, and 12 h MeJA treatment. During the cold treatment, BrcERF-B3 gene initially increased at 1 h and subsequently slowly reached peaks at the transcription level at 4 and 2 h in mutant and maintainer, respectively, then decreased slowly. The expression of the gene in mutant was significantly higher than in maintainer at 2–12 h. The transcription levels of BrcERF-B3 in mutant and maintainer was obviously down-regulated in the NaCl treatment (Fig. 9). Fig. 2 The phylogenetic analysis between BrcERF-B3 and the Arabidopsis thaliana AP2/ERF superfamily transcription factors. The phylogenetic tree was produced with the neighbor-joining method by the MEGA 5 software. The numbers above the branches indicated the reliability percent of bootstrap values from 1 000 replicates. BrcERF-B3 was boxed. The same as below

XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 531 AtERF104 AtERF105 AtERF5 AtERF6 DEWAX AtERF98 67 AIESE1 -AtESE14 B3 62 AtERF92 97 ORA59 AtERF15 AtERF13 92 AtERF2 AtERF1 96 RRTF1 BrcERF-B3 ABR1 AtRAP2.6 B4 AtRAP2.6L 81 AtRAP2.2 61 AtRAP2.12 AtERF71 B2 56 AtERF73 AtRAP2.3 AtERF10 61 AtESR1 AtESR2 99 LEP -PUCHI 16 AtERF7 B1 AtERF3 AtERF12 AtERF11 AtERF9 AtERF8 AtERF4 50 AtCRF3 AtCRF4 AtCRF2 AtCRF1 B5 AtCRF7 76 99 AtCRF8 AtCRF78 14 AtRAP2.11 AtSHINE1 84 AtESE3 AtSHINE3 AtCRF9 B6 94 AtCRF12 76 51 AtCRF10 AtCRF11 Fig.3 The phylogenetic analysis of BrcERF-B3 with each subgroup of ERF superfamily transcription factors from A.thaliana.The phylogenetic tree was produced with the neighbor-joining method by the MEGA 5 software

XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 531 Fig. 3 The phylogenetic analysis of BrcERF-B3 with each subgroup of ERF superfamily transcription factors from A. thaliana. The phylogenetic tree was produced with the neighbor-joining method by the MEGA 5 software

532 XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 Brassica rapa ssp.pekinensis Brassica rapa ssp.chinensis sica napus Eutrma salaugineum Capsella nbella Camelina sativa Arabidopsis lyrata subsp.lyrata Arabidopsis 33323388F Tarenaya hasslenana mnsps:r Brassica rapa ssp.pekinensis Brassica rapa ssp.chinensis Bra ssica napus Eutrma sala Camelina sativa Arabidopsis lyrata subsp.lyrata Arabidopsis thaliana 4464331455591454 Tarenaya hasslerian egg kirkr nkkng Brassica rapa ssp.pekinensis Brassica rapa ssp.chinensis ssica napu Eutrma salaugineum Capsella rbella Camelina sativa Arabidopsis lyrata subsp.lyrata Arabidopsis thaliana Tarenaya hassleriana arayd Brassica rapa ssp.pekinensis Brassica rapa ssp.chinensis Eutrma salaugineum CaDs8a几bea Camelina sativa Arabidopsis lyrata subsp.lyrata Arabidopsis thaliana 0招新新 Tarenaya hasslenana Fig.4 Alignment of the conserved ERF signatures of BrcERF-B3 with other ERF-B3 from different plants.The identical amino acid residues were indicated with black background,while 75%conservation was marked as gray.The deduced motifs(3 B-sheets and 1 a-helix)were marked. 98 Capsella rubella Camlina sativa 100 Arabidopsis lyrata subsp.lyrata Arabidopsis thaliana Eutrema salsugineum 100 Brassica napus 95 Brassica rapa ssp.pekinensis Brassica rapa ssp.chinensis Tarenaya hassleriana Fig.5 The homology tree was conducted to show the relationships of ERF-B3 among different plants. 3.Discussion the nucleotide sequences of two BrcERF-B3 genes were identical between these two lines.The phylogenetic tree Non-heading Chinese cabbage is an important crop in revealed that BrcERF-B3 belonged to the ERF-B3 subfamily. eastern Asia.Stamen-petalody is a novel type of male which is similar to the result study that most of 77 encoding sterility in non-heading Chinese cabbage.In this study,we ERF-like proteins of ERF superfamily belonging to B3 in rice cloned the full-ORF cDNA sequences of BrcERF-B3 from (Sharoni et al.2011).The DBD of BrcERF-B3 protein,which two non-heading Chinese cabbage lines and discovered that contained 3 anti-parallel B-sheet and 1 a-helix,combined

532 XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 3. Discussion Non-heading Chinese cabbage is an important crop in eastern Asia. Stamen-petalody is a novel type of male sterility in non-heading Chinese cabbage. In this study, we cloned the full-ORF cDNA sequences of BrcERF-B3 from two non-heading Chinese cabbage lines and discovered that the nucleotide sequences of two BrcERF-B3 genes were identical between these two lines. The phylogenetic tree revealed that BrcERF-B3 belonged to the ERF-B3 subfamily, which is similar to the result study that most of 77 encoding ERF-like proteins of ERF superfamily belonging to B3 in rice (Sharoni et al. 2011). The DBD of BrcERF-B3 protein, which contained 3 anti-parallel β-sheet and 1 α-helix, combined Fig. 4 Alignment of the conserved ERF signatures of BrcERF-B3 with other ERF-B3 from different plants. The identical amino acid residues were indicated with black background, while 75% conservation was marked as gray. The deduced motifs (3 β-sheets and 1 α-helix) were marked. Fig. 5 The homology tree was conducted to show the relationships of ERF-B3 among different plants

XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 533 2.5 ▣Maintainer ■Mutant and petal in soybean mutant line'NJS-10Hfs'which was sta men-petalody and constitutive expression of GmMADS28 in 2.0 tobacco caused early flowering and converted stamen-pet- alody and-sepalody (Huang et al.2014).S/ERF52 gene 1.5 specifically expressed in stalk and RNAi inhibited the gene expression,suggesting that S/ERF52 functioned in shedding 1.0 process of stalk(Nakano et al.2014).The expressions of BrcERF-B3 were higher in mutant than in maintainer during reproductive growth development.The BrcERF-B3 expression differences between maintainer and mutant in Seedling Rosette Budding Bolting Flowering floral buds and floral organs hinted expression of BrcERF-B3 Different development periods might affect normal formation of petals and stamens by increasing the expression profile of nuclear gene in the Fig.6 Expression of BrcERFB3 in different development bud development. periods.Seedling,five-leaf stage;rosette,fifteen-leaf stage; The transcriptional regulator with flowering,induced by budding,squaring stage;bolting,bolting stage;flowering. blossom stage.P2 mm, plant hormone and cold temperature in mutant than that respectively). in maintainer.Plant hormone and cold treatments up-reg- ulated obviously the level expression of BrcERF-B3,but the expression of BrcERF-B3 was down-regulated after Maintainer BrcERF-B3 4 h hormone stress.NaCl treatment strongly decreased the expression of BrcERF-B3 in two lines.These results Mutant BrcERF-B3 showed that BrcERF-B3 might take part in the responses to stresses in mutant,however,the regulation mechanism Actin needed the further study. Sepal Petal Stamen Carpel 4.Conclusion Fig.8 Expression of BrcERF-B3 gene in different flower organs of non-heading Chinese cabbage. In conclusion,a BrcERF-B3 gene was isolated from non-heading Chinese cabbage(Brassica rapa ssp.chinen- sis).This gene affects abnormal flower formation in mutant with the GCC box of the downstream gene promoter and line and plays a special role in biotic and abiotic stresses. activated the gene expression (Tang et al.2006). This work is likely to contribute to create new sterile materi- ERF genes had an important effect on the development als that could be applied in hybrid breeding in non-heading of flower organs.GmMADS28 expressed highly in stamen Chinese cabbage

XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 533 with the GCC box of the downstream gene promoter and activated the gene expression (Tang et al. 2006). ERF genes had an important effect on the development of flower organs. GmMADS28 expressed highly in stamen and petal in soybean mutant line ‘NJS-10Hfs’ which was sta￾men-petalody and constitutive expression of GmMADS28 in tobacco caused early flowering and converted stamen-pet￾alody and -sepalody (Huang et al. 2014). SlERF52 gene specifically expressed in stalk and RNAi inhibited the gene expression, suggesting that SlERF52 functioned in shedding process of stalk (Nakano et al. 2014). The expressions of BrcERF-B3 were higher in mutant than in maintainer during reproductive growth development. The BrcERF-B3 expression differences between maintainer and mutant in floral buds and floral organs hinted expression of BrcERF-B3 might affect normal formation of petals and stamens by increasing the expression profile of nuclear gene in the bud development. The transcriptional regulator with flowering, induced by environmental stress, would result in homeotic changes and produce flowers with an abnormal appearance (Ito et al. 2007). The ABA biosynthesis and signal transduction pathway occurred concomitantly with the transition of the apex to a closed bud structure (Ruttink et al. 2007). MeJA disrupted the balance of the gene expressions essential for cell differentiation in flower buds, being responsible for the different kinds of flower abnormalities in oilseed rape flowers (Pak et al. 2009). ERF proteins played an important role in response to salt stress. ESE1–ESE3 were induced by high salt, ESE1 regulated the expression of salt-related genes by combining with EIN3 (Zhang et al. 2011). Under cold treatment, DREB1A, DREB1B, and DREB1C expressed in Arabidopsis leaf and root, and it took part in cold-stress signal transduction pathways through the cis-element, DRE (Sakuma et al. 2001) In our experiment, BrcERF-B3 was more sensitive to plant hormone and cold temperature in mutant than that in maintainer. Plant hormone and cold treatments up-reg￾ulated obviously the level expression of BrcERF-B3, but the expression of BrcERF-B3 was down-regulated after 4 h hormone stress. NaCl treatment strongly decreased the expression of BrcERF-B3 in two lines. These results showed that BrcERF-B3 might take part in the responses to stresses in mutant, however, the regulation mechanism needed the further study. 4. Conclusion In conclusion, a BrcERF-B3 gene was isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinen￾sis). This gene affects abnormal flower formation in mutant line and plays a special role in biotic and abiotic stresses. This work is likely to contribute to create new sterile materi￾als that could be applied in hybrid breeding in non-heading Chinese cabbage. Fig. 6 Expression of BrcERFB3 in different development periods. Seedling, five-leaf stage; rosette, fifteen-leaf stage; budding, squaring stage; bolting, bolting stage; flowering, blossom stage. * , P2 mm, respectively). Sepal Actin Mutant BrcERF-B3 Maintainer BrcERF-B3 Petal Stamen Carpel Fig. 8 Expression of BrcERF-B3 gene in different flower organs of non-heading Chinese cabbage. 0 0.5 1.0 1.5 2.0 2.5 Seedling Rosette Budding Bolting Flowering Relative expression level Different development periods Maintainer Mutant ** ** * ** ** ** ** ** ** 0 2 4 6 8 10 12 14 L 1 2 3 4 Relative expression level Different development stages Maintainer Mutant

534 XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 ▣Maintainer ■Mutant ABA stress MeJA stress 3.5 3.0 .0 2 0.5 01 2 48 0 24812 Time (h) Time (h) Cold stress 1.4 NaCl stress 6 0.8 0.6 2 4 02 0 0 2 12 0 24812 Time(h) Time(h) Fig.9 Expression profiles of BrcERF-B3 gene under abiotic stresses and exogenous regulators in non-heading Chinese cabbage 5.Materials and methods ing Chinese cabbage lines was extracted in accordance with the manufacturer's instructions.The cDNA was 5.1.Plant materials synthesized by following the instructions of a PrimeS- cript RT Kit (TaKaRa,Dalian,China).The mutant leaves Seedlings of two non-heading Chinese cabbage lines(i.e., were used as templates to obtain the DNA fragment of maintainer line,and mutant)were grown in plastic pots the BrcERF-B3 gene via PCR with the suitable primer in vermiculite,peat moss(v/v=3:1)mixed substrate in a BrcERF-B3-1.PCR was performed based on the follow- controlled-environment chamber.The temperature of the ing procedure,94C for 5 min;35 cycles of 94C for 30 s. artificial climate chamber was set at 24/18C day/night 57C for 30 s,72C for 1 min;with an extension of 10 min (16/8 h)with 400 umol m-2s-1 of light intensity and relative at 72C.The amplified fragment was then recovered and (65±5)%of humidity.. subcloned into expression plasmid PMD-19 vector(TaKaRa, Dalian,China)and subjected to sequencing analysis. 5.2.Stress treatments 5.4.gRT-PCR assays of BrcERF-B3 gene The 2-mon-old seedlings of the two cabbage varieties were treated with abiotic stresses.In each case,the plants were qRT-PCR was performed with leaves at five development all grown under the same day length and light intensity as stages(seedling,rosette,budding,bolting and flowering previously noted.Four treatments were set,cold stress stages)and with buds at different flowering stages (bud (4C),salt stress (foliage spraying 200 mmol L-1 NaCl diameter:2 mm)in two lines.It aqueous solution),ABA stress(foliage spraying 100 umol depended on ABl7500(Applied Biosystems)with SYBR L-1 ABA)and MeJA stress(foliage spraying 100 umol L-1 Premix Ex-Tag (TaKaRa,Dalian,China).We used the MeJA).The samples were collected at 0,1,2,4,8,and 12 h actin gene of cabbage as an endogenous control to nor- after treatment,and frozen immediately in liquid nitrogen, malize the amplified levels of the target gene.The primer and then stored at-80C until further analysis. sequences of the actin and target BrcERF-B3 genes were listed in Table 1.The conditions of qRT-PCR system were 5.3.RNA extraction,reversing and cDNA cloning, as follows,95C for 3 min;followed by 40 cycles of 95C sequencing for 10 s,58C for 30 s.The dissolve curve analysis was then carried out at 60C.The assays were performed with The total poly (A+)RNA from the leaves of two non-head- three technical replicates

534 XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 5. Materials and methods 5.1. Plant materials Seedlings of two non-heading Chinese cabbage lines (i.e., maintainer line, and mutant) were grown in plastic pots in vermiculite, peat moss (v/v=3:1) mixed substrate in a controlled-environment chamber. The temperature of the artificial climate chamber was set at 24/18°C day/night (16/8 h) with 400 μmol m–2 s–1 of light intensity and relative (65±5)% of humidity. 5.2. Stress treatments The 2-mon-old seedlings of the two cabbage varieties were treated with abiotic stresses. In each case, the plants were all grown under the same day length and light intensity as previously noted. Four treatments were set, cold stress (4°C), salt stress (foliage spraying 200 mmol L–1 NaCl aqueous solution), ABA stress (foliage spraying 100 μmol L–1 ABA) and MeJA stress (foliage spraying 100 μmol L–1 MeJA). The samples were collected at 0, 1, 2, 4, 8, and 12 h after treatment, and frozen immediately in liquid nitrogen, and then stored at –80°C until further analysis. 5.3. RNA extraction, reversing and cDNA cloning, sequencing The total poly (A+) RNA from the leaves of two non-head￾ing Chinese cabbage lines was extracted in accordance with the manufacturer’s instructions. The cDNA was synthesized by following the instructions of a PrimeS￾cript RT Kit (TaKaRa, Dalian, China). The mutant leaves were used as templates to obtain the DNA fragment of the BrcERF-B3 gene via PCR with the suitable primer BrcERF-B3-1. PCR was performed based on the follow￾ing procedure, 94°C for 5 min; 35 cycles of 94°C for 30 s, 57°C for 30 s, 72°C for 1 min; with an extension of 10 min at 72°C. The amplified fragment was then recovered and subcloned into expression plasmid PMD-19 vector (TaKaRa, Dalian, China) and subjected to sequencing analysis. 5.4. qRT-PCR assays of BrcERF-B3 gene qRT-PCR was performed with leaves at five development stages (seedling, rosette, budding, bolting and flowering stages) and with buds at different flowering stages (bud diameter: 2 mm) in two lines. It depended on ABI7500 (Applied Biosystems) with SYBR Premix Ex-Taq (TaKaRa, Dalian, China). We used the actin gene of cabbage as an endogenous control to nor￾malize the amplified levels of the target gene. The primer sequences of the actin and target BrcERF-B3 genes were listed in Table 1. The conditions of qRT-PCR system were as follows, 95°C for 3 min; followed by 40 cycles of 95°C for 10 s, 58°C for 30 s. The dissolve curve analysis was then carried out at 60°C. The assays were performed with three technical replicates. Fig. 9 Expression profiles of BrcERF-B3 gene under abiotic stresses and exogenous regulators in non-heading Chinese cabbage. ** ** * * ** 0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 0 1 2 4 8 12 Relative expression level ABA stress ** ** ** 0 2 4 6 8 0 1 2 4 8 12 Relative expression level MeJA stress ** ** * * 0 2 4 6 8 0 1 2 4 8 12 Relative expression level Time (h) Time (h) Time (h) Time (h) Cold stress ** ** ** 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 Relative expression level 0 1 2 4 8 12 NaCl stress Maintainer Mutant

XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 535 Table 1 Nucleotide sequences of primers used in polymerase chain reaction Primer Direction Sequence(5'→3) BrcERFB3-1 F ATGCAATATCTCTACACCAG for ORF cloning BrcERFB3-1 R CTGAAACAATTCAGACATAGTG for ORF cloning BrcERFB3-2 F GGTTGTCTGCTGCGACTATTGGT for qRT-PCR BrcERFB3-2 ATCTTCCCGGGTTCCGCAAACTT for qRT-PCR actin F CTCAGTCCAAAAGAGGTATTCT for gRT-PCR actin R GTAGAATGTGTGATGCCAGATC for gRT-PCR 5.5.RT-PCR assays of BrcERF-B3 gene Hall B G.2013.Building phylogenetic trees from molecular data with MEGA.Molecular Biology and Evolution,30. RT-PCR was carried out with different flower organs in two 1229-1235. lines.Actin gene was used as an internal reference.The Hands P,Vosnakis N,Betts D,Irish VF,Drea S.2011.Altemnate BrcERF-B3 expression analysis was conducted and the transcripts of a floral developmental regulator have both amplification conditions were as follows,94C for 5 min;and distinct and redundant functions in opium poppy.Annals of Botany,.107,1557-1566. 28 cycles of94°Cfor30s,58°Cfor30s;72°Cfor30s;and Huang F,Xu GL,Chi Y J,Liu HC,Xue Q,Zhao T J,Gai JY, finally 10 min at 72C.The PCR products were detected Yu D Y.2014.A soybean MADS-box protein modulates by 1.2%agarose gel electrophoresis and visualized with floral organ numbers,petal identity and sterility.BMC Plant ethidium bromide under UV light. Biology,14,89 Ito T,Ng K H.Lim T S.Yu H,Meyerowitz E M.2007.The 5.6.Data analysis homeotic protein AGAMOUS controls late stamen development by regulating a jasmonate biosynthetic gene The amino acid sequences were carried out with the BLAST in Arabidopsis.The Plant Cell,19,3516-3529. program of Plant Transcription Factor Database(PlantTFDB. Kizis D,Lumbreras V,Pages M.2001.Role of AP2/EREBP http://planttfdb.cbi.pku.edu.cn/),the Clustal W program transcription factors in gene regulation during abiotic stress. FEBS Letters,498.187-189 package (http://www.ebi.ac.uk/clustalw/).The related se- Li MY,Wang F,Jiang Q,Ma J.Xiong AS.2013.Genome-wide quence alignment report was analyzed with DNAMAN6.0 analysis of the distribution of AP2/ERF transcription factors (http://ishare.iask.sina.com.cn/f/34031431.html).The reveals duplication and elucidates their potential function molecular phylogenetic analyses among the different ERF in Chinese cabbage(Brassica rapa ssp.pekinensis).Plant genes of Arabidopsis and different plants were conducted Molecular Biology Reporter,31,1002-1011. using MEGA 5(Hall 2013)with the neighbor-joining (NJ) McGrath K C,Dombrecht B,Manners J M,Schenk P M, method.The bootstrap value was set at 1000 replications Edgar C I,Maclean D J.Scheible W R,Udvardi M K. to assess tree reliability.The gRT-PCR results were calcu- Kazan K.2005.Repressor-and activator-type ethylene lated by the 2-AC method,where C.was the cycle threshold response factors functioning in jasmonate signaling and (Pfaffl 2001). disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression.Plant Acknowledgements Physiology,139,949-959. Nakano T,Fujisawa M,Shima Y,Ito Y.2014.The AP2/ERF transcription factor SIERF52 functions in flower pedicel This work was supported by the Independent Innovation abscission in tomato.Journal of Experimental Botany,65, Fund for Agricultural Science and Technology of Jiangsu 3111-3119. Province,China(CX(15)1015). Nakano T,Suzuki K,Fujimura T,Shinshi H.2006.Genome- wide analysis of the ERF gene family in Arabidopsis and References rice.Plant Physiology,140,411-432. Ohme-Takagi M,Shinshi H.1995.Ethylene-inducible DNA Champion A,Hebrard E,Parra B,Boumnaud C,Marmey P, binding proteins that interact with an ethylene-responsive Tranchant C,Nicole M.2009.Molecular diversity and gene element.The Plant Cell,7,173-182. expression of cotton ERF transcription factors reveal that Pak H,Guo Y,Chen MX,Chen K M,Li Y L,Hua S J,Shamsi group IXa members are responsive to jasmonate,ethylene I,Meng H B,Shi C G.Jiang L X.2009.The effect of and Xanthomonas.Molecular Plant Pathology,10,471-485. exogenous methyl jasmonate on the flowering time,floral Gutterson N,Reuber T L.2004.Regulation of disease organ morphology and transcript levels of a group of genes resistance pathways by AP2/ERF transcription factors. implicated in the development of oilseed rape flowers Current Opinion in Plant Biology,7,465-471. (Brassica napus L.).Planta,231,79-91

XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 535 5.5. RT-PCR assays of BrcERF-B3 gene RT-PCR was carried out with different flower organs in two lines. Actin gene was used as an internal reference. The BrcERF-B3 expression analysis was conducted and the amplification conditions were as follows, 94°C for 5 min; and 28 cycles of 94°C for 30 s, 58°C for 30 s; 72°C for 30 s; and finally 10 min at 72°C. The PCR products were detected by 1.2% agarose gel electrophoresis and visualized with ethidium bromide under UV light. 5.6. Data analysis The amino acid sequences were carried out with the BLAST program of Plant Transcription Factor Database (PlantTFDB, http://planttfdb.cbi.pku.edu.cn/), the Clustal W program package (http://www.ebi.ac.uk/clustalw/). The related se￾quence alignment report was analyzed with DNAMAN6.0 (http://ishare.iask.sina.com.cn/f/34031431.html). The molecular phylogenetic analyses among the different ERF genes of Arabidopsis and different plants were conducted using MEGA 5 (Hall 2013) with the neighbor-joining (NJ) method. The bootstrap value was set at 1000 replications to assess tree reliability. The qRT-PCR results were calcu￾lated by the 2–ΔΔCT method, where CT was the cycle threshold (Pfaffl 2001). Acknowledgements This work was supported by the Independent Innovation Fund for Agricultural Science and Technology of Jiangsu Province, China (CX(15)1015). References Champion A, Hebrard E, Parra B, Bournaud C, Marmey P, Tranchant C, Nicole M. 2009. Molecular diversity and gene expression of cotton ERF transcription factors reveal that group IXa members are responsive to jasmonate, ethylene and Xanthomonas. Molecular Plant Pathology, 10, 471–485. Gutterson N, Reuber T L. 2004. Regulation of disease resistance pathways by AP2/ERF transcription factors. Current Opinion in Plant Biology, 7, 465–471. Hall B G. 2013. Building phylogenetic trees from molecular data with MEGA. Molecular Biology and Evolution, 30, 1229–1235. Hands P, Vosnakis N, Betts D, Irish V F, Drea S. 2011. Alternate transcripts of a floral developmental regulator have both distinct and redundant functions in opium poppy. Annals of Botany, 107, 1557–1566. Huang F, Xu G L, Chi Y J, Liu H C, Xue Q, Zhao T J, Gai J Y, Yu D Y. 2014. A soybean MADS-box protein modulates floral organ numbers, petal identity and sterility. BMC Plant Biology, 14, 89. Ito T, Ng K H, Lim T S, Yu H, Meyerowitz E M. 2007. The homeotic protein AGAMOUS controls late stamen development by regulating a jasmonate biosynthetic gene in Arabidopsis. The Plant Cell, 19, 3516–3529. Kizis D, Lumbreras V, Pagès M. 2001. Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Letters, 498, 187–189. Li M Y, Wang F, Jiang Q, Ma J, Xiong A S. 2013. Genome-wide analysis of the distribution of AP2/ERF transcription factors reveals duplication and elucidates their potential function in Chinese cabbage (Brassica rapa ssp. pekinensis). Plant Molecular Biology Reporter, 31, 1002–1011. McGrath K C, Dombrecht B, Manners J M, Schenk P M, Edgar C I, Maclean D J, Scheible W R, Udvardi M K, Kazan K. 2005. Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression. Plant Physiology, 139, 949–959. Nakano T, Fujisawa M, Shima Y, Ito Y. 2014. The AP2/ERF transcription factor SlERF52 functions in flower pedicel abscission in tomato. Journal of Experimental Botany, 65, 3111–3119. Nakano T, Suzuki K, Fujimura T, Shinshi H. 2006. Genome￾wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiology, 140, 411–432. Ohme-Takagi M, Shinshi H. 1995. Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. The Plant Cell, 7, 173–182. Pak H, Guo Y, Chen M X, Chen K M, Li Y L, Hua S J, Shamsi I, Meng H B, Shi C G, Jiang L X. 2009. The effect of exogenous methyl jasmonate on the flowering time, floral organ morphology and transcript levels of a group of genes implicated in the development of oilseed rape flowers (Brassica napus L.). Planta, 231, 79–91. Table 1 Nucleotide sequences of primers used in polymerase chain reaction Primer Direction Sequence (5´→3´) BrcERFB3-1 F ATGCAATATCTCTACACCAG for ORF cloning BrcERFB3-1 R CTGAAACAATTCAGACATAGTG for ORF cloning BrcERFB3-2 F GGTTGTCTGCTGCGACTATTGGT for qRT-PCR BrcERFB3-2 R ATCTTCCCGGGTTCCGCAAACTT for qRT-PCR actin F CTCAGTCCAAAAGAGGTATTCT for qRT-PCR actin R GTAGAATGTGTGATGCCAGATC for qRT-PCR

536 XU Yu-chao et al.Journal of Integrative Agriculture 2016,15(3):528-536 Pfaffl M W.2001.A new mathematical model for relative Mack J.Becker A.2010.Floral homeotic C function genes quantification in real-time RT-PCR.Nucleic Acids Research, repress specific B function genes in the carpel whorl of the 29,e45. basal eudicot California poppy (Eschscholzia californica) Riechmannn JL,Heard J,Martin G,Reuber L,Jiang C Z,Keddie EvoDevo,1,13. J.Adam L,Pineda O,Ratcliffe O J.Samaha RR,Creelman Zhang LX,Li Z F,Quan R D.Li G J,Wang R G.Huang R F. R,Pilgrim M,Broun P.Zhang JZ,Ghandehari D,Sherman B 2011.An AP2 domain-containing gene,ESE1,targeted K,Yu G L.2000.Arabidopsis transcription factors,genome- by the ethylene signaling component EIN3 Is important for wide comparative analysis among eukaryotes.Science, the salt response in Arabidopsis.Plant Physiology,157, 290,2105-2110. 854-865. Ruttink T.Arend M,Morreel K,Storme V,Rombauts S,Fromm Zhang Z J,Wang J,Zhang R X,Huang R F.2012.The J,Bhalerao R P,Boerjan W,Rohde A.2007.A molecular ethylene response factor AtERF98 enhances tolerance to timetable for apical bud formation and dormancy induction salt through the transcriptional activation of ascorbic acid in poplar.The Plant Cell,19,2370-2390. synthesis in Arabidopsis.The Plant Journal,71,273-287 Sakuma Y,Liu Q,Dubouzet J G,Abe H.Shinozaki K. Zhao T J,Sun S,Liu Y,Liu J M.Liu Q.Yan Y B.Zhou H Yamaguchi-Shinozaki K.2002.DNA-binding specificity of M.2006.Regulating the drought-responsive element the ERF/AP2 domain of Arabidopsis DREBs,transcription (DRE)-mediated signaling pathway by synergic functions factors involved in dehydration-and cold-inducible of trans-active and trans-inactive DRE binding factors in gene expression.Biochemical Biophysical Research Brassica napus.The Journal of Biological Chemistry,281, Communications,290,998-1009. 10752-10759. Sharoni A M.Nuruzzaman M,Satoh K,Shimizu T,Kondoh Zhuang J,Cai B,Peng R H,Zhu B,Jin X F,Xue Y,Gao F,FuX H,Sasaya T,Choi I R,Omura T,Kikuchi S.2011.Gene Y.Tian Y S,Zhao W,Qiao Y S,Zhang Z,Xiong A S.Yao Q structures,classification and expression models of the H.2008.Genome-wide analysis of the AP2/ERF gene family AP2/EREBP transcription factor family in rice.Plant Cell in Populus trichocarpa.Biochemical Biophysical Research Physiology,52,344-360. Communications,371,468-474. Tang M J,Sun JW,Liu Y,Chen F,Shen SH.2006.Isolation and Zhuang J,Peng R H,Cheng Z M.Zhang J,Cai B,Zhang Z. functional characterization of the JcERF gene,a putative Gao F,Zhu B,Fu X Y.Chen J M.Qiao Y S,Xiong A S, AP2/EREBP domain-containing transcription factor,in the Yao Q H.2009.Genome-wide analysis of the putative AP2/ woody oil plant Jatropha curcas.Plant Molecular Biology, ERF family genes in Vitis vinifera.Scientia Horticulturae, 63,419-428. 123.73-81. Yellina A L,Orashakova S,Lange S,Erdmann R,Leebens- (Managing editor WENG Ling-yun)

536 XU Yu-chao et al. Journal of Integrative Agriculture 2016, 15(3): 528–536 Pfaffl M W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research, 29, e45. Riechmannn J L, Heard J, Martin G, Reuber L, Jiang C Z, Keddie J, Adam L, Pineda O, Ratcliffe O J, Samaha R R, Creelman R, Pilgrim M, Broun P, Zhang J Z, Ghandehari D, Sherman B K, Yu G L. 2000. Arabidopsis transcription factors, genome￾wide comparative analysis among eukaryotes. Science, 290, 2105–2110. Ruttink T, Arend M, Morreel K, Storme V, Rombauts S, Fromm J, Bhalerao R P, Boerjan W, Rohde A. 2007. A molecular timetable for apical bud formation and dormancy induction in poplar. The Plant Cell, 19, 2370–2390. Sakuma Y, Liu Q, Dubouzet J G, Abe H, Shinozaki K, Yamaguchi-Shinozaki K. 2002. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochemical Biophysical Research Communications, 290, 998–1009. Sharoni A M, Nuruzzaman M, Satoh K, Shimizu T, Kondoh H, Sasaya T, Choi I R, Omura T, Kikuchi S. 2011. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice. Plant & Cell Physiology, 52, 344–360. Tang M J, Sun J W, Liu Y, Chen F, Shen S H. 2006. Isolation and functional characterization of the JcERF gene, a putative AP2/EREBP domain-containing transcription factor, in the woody oil plant Jatropha curcas. Plant Molecular Biology, 63, 419–428. Yellina A L, Orashakova S, Lange S, Erdmann R, Leebens￾Mack J, Becker A. 2010. Floral homeotic C function genes repress specific B function genes in the carpel whorl of the basal eudicot California poppy (Eschscholzia californica). EvoDevo, 1, 13. Zhang L X, Li Z F, Quan R D, Li G J, Wang R G, Huang R F. 2011. An AP2 domain-containing gene, ESE1, targeted by the ethylene signaling component EIN3 Is important for the salt response in Arabidopsis. Plant Physiology, 157, 854–865. Zhang Z J, Wang J, Zhang R X, Huang R F. 2012. The ethylene response factor AtERF98 enhances tolerance to salt through the transcriptional activation of ascorbic acid synthesis in Arabidopsis. The Plant Journal, 71, 273–287. Zhao T J, Sun S, Liu Y, Liu J M, Liu Q, Yan Y B, Zhou H M. 2006. Regulating the drought-responsive element (DRE)-mediated signaling pathway by synergic functions of trans-active and trans-inactive DRE binding factors in Brassica napus. The Journal of Biological Chemistry, 281, 10752–10759. Zhuang J, Cai B, Peng R H, Zhu B, Jin X F, Xue Y, Gao F, Fu X Y, Tian Y S, Zhao W, Qiao Y S, Zhang Z, Xiong A S, Yao Q H. 2008. Genome-wide analysis of the AP2/ERF gene family in Populus trichocarpa. Biochemical Biophysical Research Communications, 371, 468–474. Zhuang J, Peng R H, Cheng Z M, Zhang J, Cai B, Zhang Z, Gao F, Zhu B, Fu X Y, Chen J M, Qiao Y S, Xiong A S, Yao Q H. 2009. Genome-wide analysis of the putative AP2/ ERF family genes in Vitis vinifera. Scientia Horticulturae, 123, 73–81. (Managing editor WENG Ling-yun)