Protein binds DNA at specific sequence region Domain containing protein-protein Many DNA- contacts,holding protein dimer together binding proteins DNA-binding domain fits in are dimers. major grooves and along sugar-phosphate backbone The specific DNA sequences that interact with the Inverted repeats protein are 5 3 TGTGTGGAATTGTGAGCGGATAACAATTTCACACA inverted repeats. ACACACCTTAACACTCGCCTATTGTTAAAGTGTGT 5 Inverted repeats 2012 Pearson Education,Inc.Protein binds DNA at specific sequence region Many DNA￾binding proteins are dimers. The specific DNA sequences that interact with the protein are inverted repeats