Name: TA c)Below are schematics of transcription, splicing and translation. Match the numbered boxes with the following terms. Use each number only once. It's okay to leave blanks 8 pts 3 Cap 7 Anti-cod -1 Coding(Non-template) strand __8_Co Exon 4 Intron 5 mature mRNA Polya tail Pre-mature mRNA 2 Template strand tRNA 感爱账账菜:2 4 m7-G-p-p-p-GUCGGAUGUGCCGUAGUGCAAGUCCCGGAAGAUCGCGAUCCUGGACGAUUCUAGUCCAAGUCCCGGAAGAUCGCGAUCCUGGACGAUUCAAAAAAAAAAAA3 m7-G-p-p-p-GUCGGAUGUGCCGUAGUCAUUCUAGUCCAAGUCCCGGAAGAUCGCGAUCCUGGACGAUUCAAAAAAAAAA3 5 6 m7G-P-p-p-GUCGGAUGUGqCGUAGUCCAAGUCCCGGAAGAUCGCGAUCCUGGACGAUUC d)In the box below, write the sequence that would be in box 7 above. Designate the 5 and orientations. 3pts 5’-ACG-3 e)Circle the specific name of the structure that is in box 6 above. 3 pts. Alanine Arginine Cytosine Cyanide Threonine UracilName:___________________________________ TA:_______________________ 7 c) Below are schematics of transcription, splicing and translation. Match the numbered boxes with the following terms. Use each number only once. It’s okay to leave blanks. 8 pts __3_ 5’ cap _____3’ Cap __6_ Amino acid _7__ Anti-codon __1__ Coding (Non-template) strand __8_ Codon ____ Exon __4__Intron __5_ mature mRNA ____ PolyA tail ____ Pre-mature mRNA __2__ Template strand ____ tRNA d) In the box below, write the sequence that would be in box 7 above. Designate the 5’ and 3’ orientations. 3 pts e) Circle the specific name of the structure that is in box 6 above. 3 pts. Alanine Arginine Cysteine Cytosine Cyanide Methionine Threonine Uracil 5’ – ACG – 3’ H 5