uestion 4 Below is a diagram of a transmembrane protein called Soxwin extracellular intracellular domain domain signal sequence transmembrane domain Normally Soxwin is found embedded in the plasma membrane you obtain a mutant in which Soxwin is mislocalized. the mutation resides in the dna that encodes the transmembrane domain coding sequence in WT GTTATATTTCTCGTATGGCTCGGCGTCTTATGG trp leu gly val leu trp coding sequence in mutant: GTTATATGTTCTCGTATGGCTCGGCGTCTTATGG val ile cys ser arg met ala arg arg leu met a)What type of mutation occurred in the soxwin gene? Circle your answer(s). 2pts deletion frameshift insertion missense nonsense silent b) How has this mutation changed the chemical property of the transmembrane domain? Fill in each blank with one word. 2pts From hydrophobic, non-polar in WT to hydrophilic, polar, or charged in mutant c)Where do you expect the majority of the mutant Soxwin to accumulate? Circle your answer.3 pts cytoplasm endoplasmic reticulum olgi apparatus mitochondria nucleus utside the cell peroxisomes plasma membrane ribosomes8 Question 4 Below is a diagram of a transmembrane protein called Soxwin. Normally Soxwin is found embedded in the plasma membrane. You obtain a mutant in which Soxwin is mislocalized. The mutation resides in the DNA that encodes the transmembrane domain. a) What type of mutation occurred in the soxwin gene? Circle your answer(s). 2pts deletion frameshift insertion missense nonsense silent b) How has this mutation changed the chemical property of the transmembrane domain? Fill in each blank with one word. 2pts From __hydrophobic, non-polar_ in WT to _hydrophilic, polar, or charged__ in mutant c) Where do you expect the majority of the mutant Soxwin to accumulate? Circle your answer. 3 pts cytoplasm endoplasmic reticulum golgi apparatus mitochondria nucleus outside the cell peroxisomes plasma membrane ribosomes