Question 1, continued a fragment would you expect? Write out the sequence of these double-stranded DNA ii)If the DNa shown on the previous page in(c) was cut with Bcll, how many dnA fragments 2 fragments C 5. AT1GAGGATCCGTAATGIGTCCT 5′ GATCACGCCCACG3 3, TAACTCCTAGGCATTACACAGGACTAG 5 IGCGAGGIGC d) You can ligate a restriction fragment produced in(c, i)to one produced in(c, i). Write out the sequence of the resulting fragment A +B 5 ATTGAGGATCCGTAATGTGTCCTGATCCGTAATGTGTCCTGATCACGCTCCACG 3 3/ TAACTCCTAGGCATTACACAGGACTAGGCATTACACAGGACTAGTGCGAGGTGC 5 A+D5′ AGAGGACACGCICCACG3′ or b t c b t D e) Could you cut the fragment from(d)with either BamHi or BclI? Explain. No, the recognition sites for both BanHI and for Bcll have been destroyed, 7012Fall20037.012 Fall 2003 2 Question 1, continued c) ii) If the DNA shown on the previous page in (c) was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 2 fragments. C D 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate a restriction fragment produced in (c, i) to one produced in (c, ii). Write out the sequence of the resulting fragment. A + B 5’ ATTGAGGATCCGTAATGTGTCCTGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ or A + D 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ or B + C or B + D e) Could you cut the fragment from (d) with either BamHI or BclI? Explain. No, the recognition sites for both BamHI and for BclI have been destroyed