MIT Biology Department 7.012: Introductory Biology -Fall 2004 Instructors: Professor Eric Lander, Professor Robert A Weinberg, Dr. Claudette Gardel Solutions to 7.012 Problem set 5 Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll a)Bamhi, cleaves after the first g 5 GGATCC 3 3’ CCTAGG5 Does cleavage by BamHI result in a 5 or 3 overhang? What is the sequence of this overhang? Cleavage by BamH/ leaves a 5 overhang 3 CCTAG 5 b) bcll cleaves after the first T 5 TGATCA 3 3'ACTaG 5 Does cleavage by Bcll result in a 5 or 3 overhang? What is the sequence of this overhang 5T 3 Cleavage by Bcll leaves a 5 overhang 3 ACTAG 5 c) Given the dna shown below 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3 3 TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5 i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded dna fragments 2 fragments A 5,ATTGAG 3 5,GATCCGTAATGTGTCCTGATCACGCTCCACG 3 3′ TAACICCTAG5 3,GCATTACACAGGACTAGGCGAGGTGC 5 7012Fall20037.012 Fall 2003 1 Solutions to 7.012 Problem Set 5 Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G: 5’ GGATCC 3’ 3’ CCTAGG 5’ Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ G 3’ Cleavage by BamHI leaves a 5’ overhang 3’ CCTAG 5’ b) BclI cleaves after the first T: 5’ TGATCA 3’ 3’ ACTAGT 5’ Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ T 3’ Cleavage by BclI leaves a 5’ overhang 3’ ACTAG 5’ c) Given the DNA shown below … 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments. 2 fragments: A B 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel