DNA Sequence Alignment IV Which alignments are significant? ttgacctagatgagatgtcgttcacttttactgagctacagaaaa 45 S: 403 ttgatctagatgagatgccattcacttttactgagctacagaaaa 447 Identify high scoring segments whose score S exceeds a cutoff X using dynamic programming Scores follow an extreme value distribution P(S>x=1-exp[-Kmn e-XI For sequences of length m, n where K, n depend on the score matrix and the composition of the sequences being compared (Same theory as for protein sequence alignmentsDNA Sequence Alignment IV Which alignments are significant? Q: 1 ttgacctagatgagatgtcgttcacttttactgagctacagaaaa 45 |||| |||||||||||| | ||||||||||||||||||||||||| S: 403 ttgatctagatgagatgccattcacttttactgagctacagaaaa 447 Identify high scoring segments whose score S exceeds a cutoff x using dynamic programming. Scores follow an extreme value distribution: P(S > x) = 1 - exp[-Kmn e - λ x] For sequences of length m, n where K, λ depend on the score matrix and the composition of the sequences being compared (Same theory as for protein sequence alignments)