Chapter 2 Uniformity and diversity of the cell Learning obiectives 1. Look briefly at the history of cell theory 2. Consider the basic properties of cells 3. Compare some characteristics of two different classes of cells prokaryotes and eukaryote 4. Comprehend a special life: viruses
Chapter 2 Uniformity and Diversity of the cell Learning Objectives 1. Look briefly at the history of cell theory; 2. Consider the basic properties of cells; 3. Compare some characteristics of two different classes of cells: prokaryotes and eukaryotes; 4. Comprehend a special life: viruses
1. The Cell Theory: A Brief history The discovery of cells followed from the invention of the microscope In 1665. Robert Hooke saw a network of tiny boxlike compartments that reminded him of a honeycomb. Then He called these little compartments cellulae", a Latin term meaning little room. It is from this word we get our present-day term, cell. The microscope used by Robert Hooke and the honeycomb-like network of' cell he drawed in 1665
1. The Cell Theory: A Brief History In 1665, Robert Hooke saw a network of tiny boxlike compartments that reminded him of a honeycomb. Then He called these little compartments" cellulae", a Latin term meaning little room. It is from this word we get our present-day term, cell. The microscope used by Robert Hooke and the honeycomb- like network of" cell" he drawed in 1665 The discovery of cells followed from the invention of the microscope
Cell theory has three basic tenets 1. All organisms are composed of one or more cells 2. The cell is basic unit of structure and function for all organIsms. 3. All cells arise only 区19, Schleiden(1804~1834) M 20. Schwann (1510-1s from preexisting cells by division
Cell theory has three basic tenets: 1. All organisms are composed of one or more cells. 2.The cell is basic unit of structure and function for all organisms. 3.All cells arise only from preexisting cells by division
2. Why are cells the basic units of life? A. The cell is the structural unit of life All organisms is make up of cells. Red blood testinal epithehal cells
2. Why are cells the basic units of life? A. The cell is the structural unit of life, All organisms is make up of cells
BThe cell is the functional unit of organisms All meta bolic activity is based on cells
B.The cell is the functional unit of organisms. All metabolic activity is based on cells
The cell is the foundation of reproduce, and the bridge of inheritance. The cell possess common genetic language. 等笑》3 FYY
C. The cell is the foundation of reproduce, and the bridge of inheritance. The cell possess common genetic language
Figure 6-31 Comparison of a section of the sex determination gene from two dif ferent animals. Although their body plans are strikingly different, humans and whales are built from the same proteins Despite the length of time since humans and whales diverged, the nucleotide sequences of many of their genes are still a) closely similar. The sequences of a part of the gene encoding the protein that deter- nines maleness in humans and whales are shown one above the other, and positions WHALE GTGTGGT AAGGCGAAAGGTGGCTCTAGAGAA here thethe two are identical are shaded HUMAN GTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCC
D. The cell is the growing and developing basis of life 1 cm long cm long 30 cm in leng ( b)14 weeks (c)20 weeks Human fetal development.(a)At 5 weeks, limb buds, eyes, the heart, the liver and rudiments of all other organs have started to develop in the embryo, which is only about lcm long. (b)Growth and development of the offspring, now called a fetus continue during the second trimester. This fetus is 14 weeks old and about 6cm long(cThe fetus in this photograph is 20 weeks old. Now the fetus grows to about 30cm in length
D. The cell is the growing and developing basis of life Human fetal development. (a)At 5 weeks, limb buds, eyes, the heart, the liver and rudiments of all other organs have started to develop in the embryo, which is only about 1cm long. (b)Growth and development of the offspring, now called a fetus, continue during the second trimester. This fetus is 14 weeks old and about 6cm long. (c)The fetus in this photograph is 20 weeks old. Now the fetus grows to about 30cm in length
E Cell(nucleus) is totipotent, which can create a new organism of the same type As a general rule, the cells of a multicellular organism all contain the same set of genes. For animals, the first evidence that even highly specialized cell carry a full complement of genes was verified by the experiment of tadpole nuclei transplanting into unfertilized egg that had been deprived of its own nucleus. Some can develop swimming tadpoles. This is animal cloning. An especially dramatic example of animal cloning was reported in 1997. Dolly the first animal ever cloned from a cell derived from an adult
E. Cell (nucleus) is totipotent, which can create a new organism of the same type As a general rule, the cells of a multicellular organism all contain the same set of genes. For animals, the first evidence that even highly specialized cell carry a full complement of genes was verified by the experiment of tadpole nuclei transplanting into unfertilized egg that had been deprived of its own nucleus. Some can develop swimming tadpoles. This is animal cloning. An especially dramatic example of animal cloning was reported in 1997. Dolly the first animal ever cloned from a cell derived from an adult
Dolly and her daughter The process of cloning Dolly Prepare cell culture from tssue of mamit Cell culture Remove egg Reduce serum level chromosomes in culture to arrest growth and division nd activat Is there any practical value to such technology?
Dolly and her daughter The process of cloning Dolly Is there any practical value to such technology?