REP。RTs PeeDee Belemnite(VPDB)standard and for normalized properly, each run also versus NBS-19 for 8C= 1.95% versus VPDB and 0.0%o versus air nitrogen. The first anaylsis(sealed- quots of a air nitrogen. Precision in organic st of±0.1% o of its correct as measured by including repeats of A curacy sample of known isotopic ratio in each run, was pectrometry(EA/CFIRMS) alue. Each autosampler run contained seven org ±0.10%.Ato Carlo Erba NC2500 interfaced through a Finnigan acid standards, four natural sample standards, and 40 notation, or part CONFLO lI to a Finnigan Delta XL mass spectromet of the sample amount. Samples were prepared VPDB. where 8 [=C/C)sample/(C/ organic standards and homogenous natural samples. he EA/CFIRMS analyses were calibrated as follow iler boats (measuring s m by mm) and aidf. 12.S. Carter Mem ished reut o 2 0 smpling g ersus a pulse of 99.999% pure standard gas injected rernight at 50C, the sample boats were sealed and Kennecott Point. to the mass spectrometer source immediately be neasured as follows: Isotope analyses were per- 14 M J. Orchard, PJ. Forster,Geol.Surv.Can. Pap ormed by EA/CFIRMS, using a Carlo Erba NC2500 90-10.453(1991) Because the isotope ratios obtained were dependent terfaced through a Finnigan CONFLO l to a Finni- by a grant from NSF (H. Lane, program on mixing ratios of carrier gas and dilutant in the an Delta XL mass spectrometer. Sampl dministrator) to P.D. W and by Geological Survey of Canada Project number 870070 organic standard run with the samples under the same conditions. To verify that the corrections were tope ratios calibrated in sealed-tube combustions 22 December 2000, accepted 28 March 2001 African Origin of Modern (C to T mutation, also called RPS4Y)(Fig. 1) (21, 22). Therefore, these three markers can be Humans in East Asia: A Tale of used to test the completeness of the replacement of modern humans of African origin in East Asia. An observation of a male individual not 12,000 Y Chromosomes carrying one of the three polymorphisms would be indicative of a potential ancient origin and Yuehai Ke, *Bing Su,2,1. 3* Xiufeng Song, 'Daru Lu, could possibly lead to the rejection of such Lifeng Chen, Hongyu Li, Chunjian Qi, Sangkot Marzuki completeness. Ranjan Deka, Peter Underhill, Chunjie Xiao, Mark Shriver, Each of the 12, 127 samples typed carried jeff Lell, Douglas Wallace,R Spencer Wells, one of the three polymorphisms (YAP+, Mark Seielstad, 1 Peter Oefner, 6 Dingliang Zhu, 2 Jianzhong Jin, M89T, or M130T)(Table 1). In other words, they all fall into the lineage of M168T that was Wei Huang, 2,13 Ranajit Chakraborty, Zhu Chen, 123Li Jin3,13t originally derived from Africa. Hence, no an- cient non-African y chromosome was found in To test the hypotheses of modern human origin in East Asia, we sampled 12, 127 the extant East Asian populations(P= 5.4 X male individuals from 163 populations and typed for three Y chromosome 10-0 assuming a frequency of 1/1000 of local biallelic markers(YAP, M89, and M130). All the individuals carried a mutation contribution in the extant populations), suggest- at one of the three sites. These three mutations(YAP+, M89T, and M130T) ing an absence of either an independent origin coalesce to another mutation(M168T), which originated in Africa about 35,000 or a 1,000, 000-year shared global evolution. to 89,000 years ago. Therefore, the data do not support even a minimal in situ This result indicates that modern humans of hominid contribution in the origin of anatomically modern humans in East Asia. African origin completely replaced earlier pop- ulations in East asia. TheOut-of-Africa"hypothesis suggests that typed for three Y chromosome biallelic markers atomically modern humans originated in (YAP, M89, and M130)(7, 18)(Table D). ' State Key Laboratory of Genetic Engineering Insti- Africa about 100,000 years ago and then Being a single-locus multiple-site (i.e haplo e of genetics, School of Life sciences. Fudan Uni- spread outward and completely replaced local type) system, the Y chromosome is one of the versity, 220 Handan Road, Shanghai, China 200443, archaic populations outside Africa (1, 2). most powerful molecular tools for tracing hu- and Morgan-Tan International Center for Life Scienc- This proposition has been supported by ge- man evolutionary history(, 9, 19-21). In pre- the Chinese Academy of Sciences, Kunming, Chin netic evidence and archaeological findings vious Y chromosome studies, an extreme geo- Human Genetics center 9). The replacement in Et was sup- graphic structure was revealed in global n, 1200 Herman Pressler E547, Houston, TX 77030 recent ancient DNA analyses, lations in which the oldest clade represen hich ruled out the contribution of Neander- Africans and the younger ones represent some artment of envir thals to modern Europeans (10, 11). Howev- Africans and all non-African populations(21) 5267,Us4 er, it has been argued that the abundant hom- One Y chromosome polymorphism (C to T ford, CA 94305, USA"Department of Biology Yunn inid fossils found in China and other regions mutation) at the M168 locus is shared by all University, Kunming, China. Department of Anthro in East Asia(e.g, Peking man and Java man) non-African populations and was originally de- logical characters but also in spatial and tem- 1062 globally representative male individuals 30322. use sow elcome Trust cente poral distributions(12-16). In this report, we (21). The age of M168 was estimated at 44, 000 Genetics, University of Oxford, UK. Asian human origins using Y chromosome 89,000 years), marking the recent Out-of-Africa Boston, MA 02115. UsA 12Shanghai test the competing hypotheses of modern years (95% confidence interval: 35, 000to P migrations(21). Under the M168T lineage niversity, Shanghai, China. National Human G Center at Shanghai, China. We sampled 12, 127 male individuals from there are three major derived sublineages de- contributed equally to this work. 3 populations across Southeast Asia, Oce- fined by polymorphisms at loci YAP (Alu in- espondence should be addressed. E- ania, East Asia, Siberia, and Central Asia and sertion)(), M89(C to T mutation), and M130 www.sciencemag.orgSciEnceVol29211May2001 1151
PeeDee Belemnite (VPDB) standard and for 15N 5 0.0‰ versus air nitrogen. The first anaylsis (sealedtube combustion with subsequent measurement on a Finnigan MAT 251 mass spectrometer) has a reproducibility of 6 0.08‰ for organic standards. The second analysis [elemental analyzer–continuous-flow isotope ratio mass spectrometry (EA/CFIRMS)] used a Carlo Erba NC2500 interfaced through a Finnigan CONFLO II to a Finnigan Delta XL mass spectrometer. Reproducibility in this system averages 60.12‰ for organic standards and homogenous natural samples. The EA/CFIRMS analyses were calibrated as follows: For each sample, d15N and d13C were measured versus a pulse of 99.999% pure standard gas injected into the mass spectrometer source immediately before or after the sample pulse eluted from the EA. Because the isotope ratios obtained were dependent on mixing ratios of carrier gas and dilutant in the CONFLO, the ratios were normalized to a known organic standard run with the samples under the same conditions. To verify that the corrections were normalized properly, each run also contained four aliquots of a natural sample whose ratios were known from sealed-tube combustion. This natural sample had a precision identical to the organic standard (60.12‰) and the average of four determinations was within a range of 60.1‰ of its correct value. Each autosampler run contained seven organic acid standards, four natural sample standards, and 40 samples and blanks. Blanks typically were less than 1% of the sample amount. Samples were prepared for analysis by grinding, followed by weighing into silver boats (measuring 5 mm by 9 mm) and acidifi- cation with 20 ml of 50% HCl. After air drying overnight at 50°C, the sample boats were sealed and measured as follows: Isotope analyses were performed by EA/CFIRMS, using a Carlo Erba NC2500 interfaced through a Finnigan CONFLO II to a Finnigan Delta XL mass spectrometer. Sample isotope ratios were normalized in each run to the values obtained for an organic standard with known isotope ratios calibrated in sealed-tube combustions versus NBS-19 for d13C 5 1.95‰ versus VPDB and for d15N 5 0.0‰ versus air nitrogen. Precision in this system averages 60.12‰ for organic standards and homogenous natural samples. Accuracy, as measured by including repeats of a natural sample of known isotopic ratio in each run, was 60.10‰. All isotope ratios are expressed in delta notation, or parts per thousand deviation from VPDB, where d13C 5 {[(13C/12C)sample/(13C/ 12C)VPDB] 2 1} 3 1000. 12. E. S. Carter, Mem. Geol. (Lausanne) 11, 175 (1993). 13. E. S. Carter, unpublished results of 2000 sampling at Kennecott Point. 14. M. J. Orchard, P. J. L. Forster, Geol. Surv. Can. Pap. 90-10, 453 (1991). 15. Supported by a grant from NSF (H. Lane, program administrator) to P.D.W. and by Geological Survey of Canada Project number 870070. 22 December 2000; accepted 28 March 2001 African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes Yuehai Ke,1 * Bing Su,2,1,3* Xiufeng Song,1 Daru Lu,1 Lifeng Chen,1 Hongyu Li,1 Chunjian Qi,1 Sangkot Marzuki,4 Ranjan Deka,5 Peter Underhill,6 Chunjie Xiao,7 Mark Shriver,8 Jeff Lell,9 Douglas Wallace,9 R Spencer Wells,10 Mark Seielstad,11 Peter Oefner,6 Dingliang Zhu,12 Jianzhong Jin,1 Wei Huang,12,13 Ranajit Chakraborty,3 Zhu Chen,12,13 Li Jin1,3,13 † To test the hypotheses of modern human origin in East Asia, we sampled 12,127 male individuals from 163 populations and typed for three Y chromosome biallelic markers (YAP, M89, and M130). All the individuals carried a mutation at one of the three sites. These three mutations (YAP1, M89T, and M130T) coalesce to another mutation (M168T), which originated in Africa about 35,000 to 89,000 years ago. Therefore, the data do not support even a minimal in situ hominid contribution in the origin of anatomically modern humans in East Asia. The “Out-of-Africa” hypothesis suggests that anatomically modern humans originated in Africa about 100,000 years ago and then spread outward and completely replaced local archaic populations outside Africa (1, 2). This proposition has been supported by genetic evidence and archaeological findings (3–9). The replacement in Europe was supported by recent ancient DNA analyses, which ruled out the contribution of Neanderthals to modern Europeans (10, 11). However, it has been argued that the abundant hominid fossils found in China and other regions in East Asia (e.g., Peking man and Java man) demonstrate continuity, not only in morphological characters but also in spatial and temporal distributions (12–16). In this report, we test the competing hypotheses of modern Asian human origins using Y chromosome polymorphisms. We sampled 12,127 male individuals from 163 populations across Southeast Asia, Oceania, East Asia, Siberia, and Central Asia and typed for three Y chromosome biallelic markers (YAP, M89, and M130) (17, 18) (Table 1). Being a single-locus multiple-site (i.e., haplotype) system, the Y chromosome is one of the most powerful molecular tools for tracing human evolutionary history (5, 9, 19–21). In previous Y chromosome studies, an extreme geographic structure was revealed in global populations in which the oldest clade represents Africans and the younger ones represent some Africans and all non-African populations (21). One Y chromosome polymorphism (C to T mutation) at the M168 locus is shared by all non-African populations and was originally derived from Africa on the basis of a study of 1062 globally representative male individuals (21). The age of M168 was estimated at 44,000 years (95% confidence interval: 35,000 to 89,000 years), marking the recent Out-of-Africa migrations (21). Under the M168T lineage, there are three major derived sublineages defined by polymorphisms at loci YAP (Alu insertion) (5), M89 (C to T mutation), and M130 (C to T mutation, also called RPS4Y) (Fig. 1) (21, 22). Therefore, these three markers can be used to test the completeness of the replacement of modern humans of African origin in East Asia. An observation of a male individual not carrying one of the three polymorphisms would be indicative of a potential ancient origin and could possibly lead to the rejection of such completeness. Each of the 12,127 samples typed carried one of the three polymorphisms (YAP1, M89T, or M130T) (Table 1). In other words, they all fall into the lineage of M168T that was originally derived from Africa. Hence, no ancient non-African Y chromosome was found in the extant East Asian populations (P 5 5.4 3 1026 assuming a frequency of 1/1000 of local contribution in the extant populations), suggesting an absence of either an independent origin or a 1,000,000-year shared global evolution. This result indicates that modern humans of African origin completely replaced earlier populations in East Asia. 1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, 220 Handan Road, Shanghai, China 200443, and Morgan-Tan International Center for Life Sciences, Shanghai, China. 2 Kunming Institute of Zoology, the Chinese Academy of Sciences, Kunming, China. 3 Human Genetics Center, University of Texas–Houston, 1200 Herman Pressler E547, Houston, TX 77030, USA. 4 Eijkman Institute for Molecular Biology, Jakarta, Indonesia. 5 Department of Environmental Health, University of Cincinnati, Cincinnati, OH 45267, USA. 6 Department of Genetics, Stanford University, Stanford, CA 94305, USA. 7 Department of Biology, Yunnan University, Kunming, China. 8 Department of Anthropology, Pennsylvania State University, University Park, PA 16802, USA. 9 Center for Molecular Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA. 10Wellcome Trust Center for Human Genetics, University of Oxford, UK. 11Program for Population Genetics, Harvard School of Public Health, Boston, MA 02115, USA. 12Shanghai Second Medical University, Shanghai, China. 13National Human Genome Center at Shanghai, China. *These authors contributed equally to this work. †To whom correspondence should be addressed. Email: ljin@fudan.edu or ljin@sph.uth.tmc.edu R EPORTS www.sciencemag.org SCIENCE VOL 292 11 MAY 2001 1151
REP。RTs mosome/autosome(three to four times as many as the former) in the presence of bottleneck M88 from Africa, therefore disqualifying the utility f the latter in distinguishing the competing hypotheses(24, 30) References and notes 1. R L Cann, M. Stoneking A. C. Wilson, Nature 325, 31 A.C. wilson, Science 253, 1503(15 African Arcan+ Non-Afrlcan 3. C.B. Stringer, P. Andrew, Science 239, 1263(1988). g 1. The phylog tionships of the Y chromosome haplotypes of African and other world populations. The red branches are African-specific haplotypes. The blue branches are non-African- specific haplotypes, and the green ones are shared between Africans and non-Africans (modified 6. S A Tishkoff et al. Science 271, 1380(1996) from Underhill et al.(21)I 7. JY. Chu et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 Npopt number of populations: Nind, number of individuals. 11. V.O. Igor et al., Nature 404, 490(2000) 12. AS.Brooks, B Wood, Nature 344, 288(1990) Geographic region N M130T YAP+ 13. T Li, D A. Etler, Nature 357, 404(1992) 14. x. Z. Wu, F. E. Poirier, Human Evolution in China Central siberia 70 anthropOl25.275(1996) Okhotsk/Amur 3564 567929g072 16. C.C. Swisher et aL, Science 274, 1870(1996). Kamchatka/ Chukotka 102 Northern East Asia Northern han Chinese 459 Southern han chinese 3575 5127 entral Siberia(Tuvan, Tofala Taiwanese Aborigines ey Evenk, Buryat-1, and Buryat-2): Okhotsk/Amur Okhotsk Evenk, Ulchi/Nanai, Upriver NegidaL, hatka/ Chukotka( Koryak, Item Guinea/melanesia ortheast india Kazak-Xinjiang, and Uyghur): northern Han Chinese It was argued that the extensive genetic data would have been expected in East Asia, which supporting the Out-of-Africa hypothesis could was not observed in our data. However, this also be explained by the multiregional hypoth- observation does not necessarily preclude the ubei, Sichuan, Jiangxi Guangxi, Guangdong, and Guizhou): Taiwan(Bu esis under a version of the trellis model(23). possibility of selection sweep that could erase This model suggests that a multiregional evo- archaic Y chromosomes of modern humans in utionary paradigm is shared across the human East Asia. On the other hand, a minor contri- range by frequent gene exchanges between con- bution from a female lineage of local origin Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, tinental populations since Homo erectus came cannot be excluded either, which should b Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Nort out of Africa about 1 million years ago(23). It further studied with the use of mitochondrial Bai-1, and Bai-2): IndonesiaMalaysia [Malay CB, Malay KM, Orang is difficult to test the trellis model with markers DNA(mtDNA)markers. Because the y chro- Asli, Batak, Malay (Pakanbaru). Minangkabau, rom mitochondrial hypervariable region(D- mosome has a relatively small effective pop loop) and autosome because these markers ulation size, it is subject to stochastic process, show frequent recurrent mutations and/or re- e.g, genetic drift, which could also lead to nd Sakai]: Polynesia/Micronesia(Truk,Guam,Pa- combination(24, 25), respectively. However, extinction of archaic lineages. However, in lau, Majuro, Kribati, Pohnpei, Nauru, Kapingama this can be circumvented by the application of a our study, with 163 populations from differ- rangi, Tonga, American Somoan, and West So- large number of Y chromosome biallelic mark- ent regions of Asia, it is hard to imagine that ers, which escape recombination and have a all of the 163 populations should drift in the n-1, New Guinean-2, Bankes and Torres, Santo low mutation rate. It has been shown that all the same direction and Maewo) Y chromosome haplotypes found outside Afri- Assam abha(Assam), and Naga. The ca are younger than 35, 000 to 89,000 years and mon ancestor with the use of mitochondrial/Y numbered populations of the same ethnicity were rived from Africa(2), although this estima- chromosome and autosome/x chromosome 18. Genotyping was conducted by a polymerase chain tion is crude and depends on several assump markers, however, creates confusion. The age tions. In addition, if extensive gene flow had estimated with the use of autosome/X chromo- e engineered for MT occurred between continental populations dur- some genes ranges from 535,000 to 1, 860,000 (Bsl n)and M89(Nla In) by designing misma ing the past 1 million years but before the years(26-29), much older than those for divergence between Africans and non-Africans, mtDNA and Y chromosome. However, this (M89)and TATCTCCTCT TCTAT TGCAG/CCACAAGG- cient y chromosome haplotypes seen in Afri- the difference in the effective population sizes prerious reports 5. 9) ien ping was repeated to can populations or even much older haplotypes between Y chromosome/mtDNA and X chro- 19. M A Jobling et al, Trends Genet. 11, 449( 1995) 1152 11 MAY 2001 VOL 292 SCIENCE .sClencemag org
It was argued that the extensive genetic data supporting the Out-of-Africa hypothesis could also be explained by the multiregional hypothesis under a version of the trellis model (23). This model suggests that a multiregional evolutionary paradigm is shared across the human range by frequent gene exchanges between continental populations since Homo erectus came out of Africa about 1 million years ago (23). It is difficult to test the trellis model with markers from mitochondrial hypervariable region (Dloop) and autosome because these markers show frequent recurrent mutations and/or recombination (24, 25), respectively. However, this can be circumvented by the application of a large number of Y chromosome biallelic markers, which escape recombination and have a low mutation rate. It has been shown that all the Y chromosome haplotypes found outside Africa are younger than 35,000 to 89,000 years and derived from Africa (21), although this estimation is crude and depends on several assumptions. In addition, if extensive gene flow had occurred between continental populations during the past 1 million years but before the divergence between Africans and non-Africans, as suggested by the multiregionalists, the ancient Y chromosome haplotypes seen in African populations or even much older haplotypes would have been expected in East Asia, which was not observed in our data. However, this observation does not necessarily preclude the possibility of selection sweep that could erase archaic Y chromosomes of modern humans in East Asia. On the other hand, a minor contribution from a female lineage of local origin cannot be excluded either, which should be further studied with the use of mitochondrial DNA (mtDNA) markers. Because the Y chromosome has a relatively small effective population size, it is subject to stochastic process, e.g., genetic drift, which could also lead to extinction of archaic lineages. However, in our study, with 163 populations from different regions of Asia, it is hard to imagine that all of the 163 populations should drift in the same direction. Inconsistency of age estimations for a common ancestor with the use of mitochondrial/Y chromosome and autosome/X chromosome markers, however, creates confusion. The age estimated with the use of autosome/X chromosome genes ranges from 535,000 to 1,860,000 years (26–29), much older than those for mtDNA and Y chromosome. However, this difference in age estimation might only reflect the difference in the effective population sizes between Y chromosome/mtDNA and X chromosome/autosome (three to four times as many as the former) in the presence of bottleneck events associated with the outbound migrations from Africa, therefore disqualifying the utility of the latter in distinguishing the competing hypotheses (24, 30). References and Notes 1. R. L. Cann, M. Stoneking, A. C. Wilson, Nature 325, 31 (1987). 2. L. Vigilant, M. Stoneking, H. Harpending, K. Hawkes, A. C. Wilson, Science 253, 1503 (1991). 3. C. B. Stringer, P. Andrew, Science 239, 1263 (1988). 4. A. M. Bowcock et al., Nature 368, 455 (1994). 5. M. F. Hammer, Nature 378, 376 (1995). 6. S. A. Tishkoff et al., Science 271, 1380 (1996). 7. J. Y. Chu et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998). 8. L. Quintana-Murci et al., Nature Genet. 23, 437 (1999). 9. B. Su et al., Am. J. Hum. Genet. 65, 1718 (1999). 10. M. Krings et al., Cell 90, 19 (1997). 11. V. O. Igor et al., Nature 404, 490 (2000). 12. A. S. Brooks, B. Wood, Nature 344, 288 (1990). 13. T. Li, D. A. Etler, Nature 357, 404 (1992). 14. X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995). 15. D. A. Etler, Annu. Rev. Anthropol. 25, 275 (1996). 16. C. C. Swisher et al., Science 274, 1870 (1996). 17. A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, InnerMongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia ( Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia ( Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently. 18. Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results. 19. M. A. Jobling et al., Trends Genet. 11, 449 (1995). Table 1. Frequency distribution of the three Y chromosome polymorphisms in 163 Asian populations. NPop, number of populations; NInd, number of individuals. Geographic region NPop NInd M89T M130T YAP1 Central Asia 13 173 144 25 4 Central Siberia 5 107 70 36 1 Okhotsk/Amur 6 123 46 77 0 Kamchatka/Chukotka 4 102 73 29 0 Northern East Asia 17 578 497 42 39 Northern Han Chinese 14 4592 4296 191 105 Southern Han Chinese 13 5127 4984 97 44 Taiwanese Aborigines 5 58 58 0 0 Southeast Asia 37 620 559 37 24 Indonesia/Malaysia 25 355 333 22 0 Polynesia/Micronesia 11 113 89 23 1 New Guinea/Melanesia 7 120 105 17 0 Northeast India 6 59 57 2 0 Total 163 12,127 Fig. 1. The phylogenetic relationships of the Y chromosome haplotypes of African and other world populations. The red branches are African-specific haplotypes. The blue branches are non-African– specific haplotypes, and the green ones are shared between Africans and non-Africans [modified from Underhill et al. (21)]. R EPORTS 1152 11 MAY 2001 VOL 292 SCIENCE www.sciencemag.org
REP。RTs O P A Underhill et al., Ann. Hum. Genet. 65, 43(2001). 26. R. M. Harding et al, Am. J. Hum. Genet. 60, 772 31. We thank all the 12, 127 men who donated DNA fo 22. A w. Bergen et al., Ann. Hum. Genet. 63, 63(1999). 27(1997) 21. P. A Underhill et al, Nature Genet. 26, 358(2000). his study. This stu Kaessmann, F. Heissig, A. Haeseler, S. Paabo, Na- Foundation. B.S.,R. C. and L.w Genet.2278(199 23. M. H. Wolpoff, J. Hawks, R. Caspari, Am. J. Phys. 28. E. Harris, I Hey. Proc. Natl.Acad. Sci. U..A.96, 3320 supported by NIH grants. R.D. was supported by the Anthropol. 112, 129(2000). Center for Environmental genetics at the univer (1999) 24. L Jin, B Su, Nature Rev. Genet. 1. 126(2000). of Cincinnati 29. Z. M. Zhao et al. Proc. Natl. Acad. Sci. U.S.A. 97 25. M. Stoneking et al, Curr. Opin. Genet. Dev. 6. 731 (1996 30. J.C. Fay, C I Wu, Mol. Biol. EvoL. 16, 1003(1999) 20 February 2001: accepted 20 March 2001 Spermiogenesis Deficiency in complex process referred to as"spermat sis. "The mouse spermatogenesis cycle Mice Lacking the Trf2 Gene defined and can be subdivided into 12 with each stage consisting of a specific com- plement of male germ cells. In determining the Di Zhang, Tarja-Leena Penttila, Patricia L Morris, 2.3 nature of the sperm deficiency, we analyzed Martin Teichmann Robert G. Roeder male germ cell differentiation both in adult mice and in juvenile mice between 8 and 35 The discovery of TATA-binding protein-related factors(TRFs) has suggested days after birth. In the latter case, the first wave alternative mechanisms for gene-specific transcriptional regulation and raised of developing germ cells progresses through interest in their biological functions. In contrast to recent observations of an spermatogenesis with specific mitotic and mei- embryonic lethal phenotype for TRF2 inactivation in Caenorhabditis elegans and otic cells first appearing according to a well- Xenopus laevis, we found that Trf2-deficient mice are viable. However, Trf 2- characterized developmental program(12). In- mice are sterile because of a severe defect in spermiogenesis. Postmeiotic round spection of seminiferous tubules in the adult We speculate that mammals may have evolved more specialized TRFZ functions in the testis that involve transcriptional regulation of genes essential for Early studies have suggested that one universal chain reaction analysis revealed a Tr2+/+ TATA-binding protein(TBP) functions as a Trf2+/-: Trf2-- distribution (69: 109: 40)that central component of the general transcription does not deviate significantly from the expected machineries to mediate transcription by nuclear Mendelian ratio, although there could be some RNA polymerases I, Il, and Ill in eukaryotes earlier lethality of homozygous embryos. Dis (1). However, the identification of two TBP- ruption of the Trf2 gene was confirmed by related factors (TRFl and TRF2)raised the Southern blot analysis (I1). Subsequent North possibility that TRFs may substitute for TBP in en blot analyses of testis RNAs from Trf2 mediating the transcription of specific genes mutant mice showed reduced expression of full and thus have distinct biological functions(2- length Trf2 transcripts in heterozygotes and no 5). In Drosophila, biochemical studies have expression in homozygotes (In) TRF1(6, 7). In both Caenorhabditis elegans to be healthy and showed no apparent abnor. 5 5258 documented promoter-specific functions of Mice deficient for the Trf2 and Xenopus laevis, inactivation of TRF2 re- malities in major organs at the gross and histo- EG sults in embryonic lethality and deficiencies in logical levels. However, testes from the adult embryonic gene transcription(8-10). However, Trf2-deficient mice showed size and weight except for the observation that TRF2 is abun- reductions of -50% in comparison with those dantly expressed in the testis of human and from the wild-type and heterozygous controls mouse(4, 5), there has been no information (In). When Trf2-- male mice were mated with regarding biological functions of TRF2 in Trf2+/+ female mice, they copulated normal- mammalian species ly, as evidenced by the formation of vaginal To elucidate the functional role of TRF2, we plugs in their mates, but none of the mated fe- gl. rf2- mice show defects in spermiogen- used homologous recombination in embryonic male mice became pregnant. In contrast, Trf 2- tions from adult T 2+/+(A)and Trf2*-(B) stem cells to generate mice lacking a functional females were fertile and produced normal av- littermates Magnification, X200. Arrows indicat tor in which a region containing the central four of serum tes one levels in Tr/2--male are present in Trf 2 +/+ but absent in the Trf2-k exons of Trf2 was replaced by a neomycin mice revealed no statistically significant differ estis. (C and D)Histological analysis of testis resistance gene cassette(ID). This deletion elim- ence in comparison to their Tr2*/*or 72+ sections from T f2+/+(C)and Trf2--(D)juv ates nearly 80% of the core region of TRF2. littermates(In). We next evaluated semen sam- The arrow indicates the elongated spermatids Genotyping of 218 F, offspring by polymerase ples extracted from the vas deferens and epid- that are present in Trf 2+/+ but absent in the dymis. The seminal fluid from Trf2--mice 2-- testis.(E and "Laboratory of Biochemistry and Molecular Biology lacked spermatozoa, whereas there were no ap s tubules at stage VI from Trf2+/+(E)and parent differences in sperm number or morpho Trf2--(F) juvenile mice of 25 days of age. Mag- nification x 1000. Arrows indicate the acrosomes USA. Population Council, New York, NY 10021, USA. ogy between Tr/2+/ and Tr/2+ mice(n). of the spermatids, which are stained pink. Th correspondence should be addressed. E In the testis, male germ cells differentiate nal in the trf2- ler@rockvax rockefeller edu from spermatogonia into spermatozoa by a section, as compared to the Trf 2+/+ section. www.sciencemag.orgSciEnceVol29211May2001 1153
20. P. A. Underhill et al., Ann. Hum. Genet. 65, 43 (2001). 21. P. A. Underhill et al., Nature Genet. 26, 358 (2000). 22. A. W. Bergen et al., Ann. Hum. Genet. 63, 63 (1999). 23. M. H. Wolpoff, J. Hawks, R. Caspari, Am. J. Phys. Anthropol. 112, 129 (2000). 24. L. Jin, B. Su, Nature Rev. Genet. 1, 126 (2000). 25. M. Stoneking et al., Curr. Opin. Genet. Dev. 6, 731 (1996). 26. R. M. Harding et al., Am. J. Hum. Genet. 60, 772 (1997). 27. H. Kaessmann, F. Heissig, A. Haeseler, S. Paabo, Nature Genet. 22, 78 (1999). 28. E. Harris, J. Hey, Proc. Natl. Acad. Sci. U.S.A. 96, 3320 (1999). 29. Z. M. Zhao et al., Proc. Natl. Acad. Sci. U.S.A. 97, 11354 (2000). 30. J. C. Fay, C. I. Wu, Mol. Biol. Evol. 16, 1003 (1999). 31. We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati. 20 February 2001; accepted 20 March 2001 Spermiogenesis Deficiency in Mice Lacking the Trf2 Gene Di Zhang,1 Tarja-Leena Penttila,3 Patricia L. Morris,2,3 Martin Teichmann,1 Robert G. Roeder1 * The discovery of TATA-binding protein–related factors (TRFs) has suggested alternative mechanisms for gene-specific transcriptional regulation and raised interest in their biological functions. In contrast to recent observations of an embryonic lethal phenotype for TRF2 inactivation in Caenorhabditis elegans and Xenopus laevis, we found that Trf2-deficient mice are viable. However, Trf 2–/– mice are sterile because of a severe defect in spermiogenesis. Postmeiotic round spermatids advance at most to step 7 of differentiation but fail to progress to the elongated form, and gene-specific transcription deficiencies were identified. We speculate that mammals may have evolved more specialized TRF2 functions in the testis that involve transcriptional regulation of genes essential for spermiogenesis. Early studies have suggested that one universal TATA-binding protein (TBP) functions as a central component of the general transcription machineries to mediate transcription by nuclear RNA polymerases I, II, and III in eukaryotes (1). However, the identification of two TBPrelated factors (TRF1 and TRF2) raised the possibility that TRFs may substitute for TBP in mediating the transcription of specific genes and thus have distinct biological functions (2– 5). In Drosophila, biochemical studies have documented promoter-specific functions of TRF1 (6, 7). In both Caenorhabditis elegans and Xenopus laevis, inactivation of TRF2 results in embryonic lethality and deficiencies in embryonic gene transcription (8–10). However, except for the observation that TRF2 is abundantly expressed in the testis of human and mouse (4, 5), there has been no information regarding biological functions of TRF2 in mammalian species. To elucidate the functional role of TRF2, we used homologous recombination in embryonic stem cells to generate mice lacking a functional Trf2 gene (11). We constructed a targeting vector in which a region containing the central four exons of Trf2 was replaced by a neomycin resistance gene cassette (11). This deletion eliminates nearly 80% of the core region of TRF2. Genotyping of 218 F2 offspring by polymerase chain reaction analysis revealed a Trf21/1: Trf21/2:Trf2 2/2 distribution (69:109:40) that does not deviate significantly from the expected Mendelian ratio, although there could be some earlier lethality of homozygous embryos. Disruption of the Trf2 gene was confirmed by Southern blot analysis (11). Subsequent Northern blot analyses of testis RNAs from Trf2 mutant mice showed reduced expression of fulllength Trf2 transcripts in heterozygotes and no expression in homozygotes (11). Mice deficient for the Trf2 gene appeared to be healthy and showed no apparent abnormalities in major organs at the gross and histological levels. However, testes from the adult Trf2-deficient mice showed size and weight reductions of ;50% in comparison with those from the wild-type and heterozygous controls (11). When Trf2–/– male mice were mated with Trf2 1/1 female mice, they copulated normally, as evidenced by the formation of vaginal plugs in their mates, but none of the mated female mice became pregnant. In contrast, Trf2–/– females were fertile and produced normal average litter sizes (7.3 6 1.8; n 5 10). Analyses of serum testosterone levels in Trf2–/– male mice revealed no statistically significant difference in comparison to their Trf2 1/1 or Trf2 1/– littermates (11). We next evaluated semen samples extracted from the vas deferens and epididymis. The seminal fluid from Trf2–/– mice lacked spermatozoa, whereas there were no apparent differences in sperm number or morphology between Trf2 1/1 and Trf2 1/– mice (11). In the testis, male germ cells differentiate from spermatogonia into spermatozoa by a complex process referred to as “spermatogenesis.” The mouse spermatogenesis cycle is well defined and can be subdivided into 12 stages, with each stage consisting of a specific complement of male germ cells. In determining the nature of the sperm deficiency, we analyzed male germ cell differentiation both in adult mice and in juvenile mice between 8 and 35 days after birth. In the latter case, the first wave of developing germ cells progresses through spermatogenesis with specific mitotic and meiotic cells first appearing according to a wellcharacterized developmental program (12). Inspection of seminiferous tubules in the adult 1 Laboratory of Biochemistry and Molecular Biology, 2 The Rockefeller University, New York, NY 10021, USA. 3 Population Council, New York, NY 10021, USA. *To whom correspondence should be addressed. Email: roeder@rockvax.rockefeller.edu Fig. 1. Trf2–/– mice show defects in spermiogenesis. (A and B) Histological analysis of testis sections from adult Trf21/1 (A) and Trf2–/– (B) littermates. Magnification, 3200. Arrows indicate the elongated spermatids or spermatozoa that are present in Trf2 1/1 but absent in the Trf2–/– testis. (C and D) Histological analysis of testis sections from Trf2 1/1 (C) and Trf2–/– (D) juvenile mice of 28 days of age. Magnification, 3200. The arrow indicates the elongated spermatids that are present in Trf2 1/1 but absent in the Trf2–/– testis. (E and F) Morphology of seminiferous tubules at stage VI from Trf2 1/1 (E) and Trf2–/– (F) juvenile mice of 25 days of age. Magnification, 31000. Arrows indicate the acrosomes of the spermatids, which are stained pink. The acrosomal structures are abnormal in the Trf2–/– section, as compared to the Trf2 1/1 section. R EPORTS www.sciencemag.org SCIENCE VOL 292 11 MAY 2001 1153