Primer Design and Computer Program Sean Tsai @2008,National Cheng Kung University Medical College
Primer Design and Computer Program Sean Tsai ©2008, National Cheng Kung University Medical College
Outlines What is a primer? ● Does it really matter? Principles of Primer Design Can I trust my gut feeling? What should I do?
Outlines What is a primer? Does it really matter? Principles of Primer Design Can I trust my gut feeling? What should I do?
What is a primer? A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing.These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal. 3 TGACCTGAAAAGAC←—Primer TGATTACCGATGACTGGACTTTTCTG Te ←-Annealing
What is a primer? A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing. These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal
No copies of template DNA Cycle 1 Target sequence Cycle2↓ Cycle 3 ◆ ◆ ◆ After n-th cycle 一 No Noxn Nox(1+Y)-1
After n-th cycle N0 N0 x n N0 x (1+Y)n-1 Cycle 1 Cycle 2 Cycle 3 Target sequence N0 copies of template DNA
Does it Really Matter? A successful PCR is determined primarily by the quality of primer chosen. Examples: 1.Story of monkey progesterone receptor ---A single base mismatch at the 3'end of the primer 2.Story of bovine prostaglandin E2 receptor EP3 subtype ---Too many homology sequences in the mRNA transcripts 3.Story of human gonadotropin releasing hormone(GnRH) --Difference of primer Tm
Does it Really Matter? • A successful PCR is determined primarily by the quality of primer chosen. • Examples: --- A single base mismatch at the 3’ end of the primer --- Difference of primer Tm --- Too many homology sequences in the mRNA transcripts 1. Story of monkey progesterone receptor 3. Story of human gonadotropin releasing hormone (GnRH) 2. Story of bovine prostaglandin E2 receptor EP3 subtype
Principles of Primer Design Use the right sequences 。 Optimal length of PCR product Proper length of primer Suitable annealing temperature Avoid hairpin and stem-loop formation Minimize primer self-annealing Other factors:Mg2,DNA,dNTP concentrations and 9A7A
Principles of Primer Design • Use the right sequences • Optimal length of PCR product • Proper length of primer • Suitable annealing temperature • Avoid hairpin and stem-loop formation • Minimize primer self-annealing • Other factors: Mg2+, DNA, dNTP concentrations and
Principles of Primer Design Use the right sequence Yes Consider the length Species specific of PCR product No Beef,pork,chicken,mouse,or rat? Find consensus Sequence Comparison sequences between different species
Principles of Primer Design • Use the right sequence Beef, pork, chicken, mouse, or rat? Species specific Yes No Consider the length of PCR product Find consensus sequences between different species Sequence Comparison
Principles of Primer Design Optimal length of PCR product A.Cloning cDNA:Full length B.For probing:150 -300 bp C.Checking Polymorphism:100-300 bp D.Quantification:300 -500 bp E.General:300 -1000 bp Proper restriction sites,Cross intron
Principles of Primer Design • Optimal length of PCR product B. For probing: 150 - 300 bp A. Cloning cDNA: Full length C. Checking Polymorphism: 100 - 300 bp D. Quantification: 300 - 500 bp E. General: 300 - 1000 bp Proper restriction sites, Cross intron
Principles of Primer Design Proper length of primer Usually:18 22 bases Too short Too long Special considerations: Linkers,Restriction enzyme sites, Complementary to specific sequences
Principles of Primer Design • Proper length of primer Usually: 18 - 22 bases Too short Too long Special considerations: Linkers, Restriction enzyme sites, Complementary to specific sequences
Principles of Primer Design Suitable annealing temperature Depends on primer length and GC content GC content:45-60% Tm:55-61°C Difference in Tm:=<2C
Principles of Primer Design • Suitable annealing temperature Depends on primer length and GC content GC content: 45-60% Tm:55 - 61°C Difference in Tm: =< 2°C