Lecture 8 ·88 Attenuation 8. 9 Other global control networks 8. 10 Signal Transduction and Two Component Regulatory Systems 8.11 Regulation of Chemotaxis
Lecture 8 • 8.8 Attenuation • 8.9 Other Global Control Networks • 8.10 Signal Transduction and TwoComponent Regulatory Systems • 8.11 Regulation of Chemotaxis
RNA and termination RNA: single stranded nucleic acid can form secondary structures Rho-dependent termination: protein signal Rho-independent signal: hairpin or stem loop Rna structure, followed by several uracil
RNA and termination • RNA: single stranded nucleic acid – can form secondary structures • Rho-dependent termination: protein signal • Rho-independent signal: hairpin or stemloop RNA structure, followed by several uracils
TGCGGGTCGACTGICCGATICAGTCGACCITTT DNA with ACGCICCAGCTGACGGCTAGTCAGCTGGAAAA inverted repeats Transcription of one strand UGCGGGUCGACUGCCGAUCAGUCGACCUUUU RNA Fold to form secondary structure UGCGY UUUU GGUC C A Stem-loop in RNA immediately upstream from a run of uracils leads to terminati UIA of transcription G C G
Tryptophan Operon PO L trpE trpD trpC trpB trpA Leader Met-Lys-Ala-Ile-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser Threonine Met-Lys-Arg-lle-Ser-Thr-Thr-lle-Thr-Thr-Thr-lle-Thr- lle-Thr-Thr-Gly-Asn-Gly-Ala-Gly Histidine Met-Thr-Arg-Val-GIn-Phe-Lys-His-His-His-His His-His-His-Pro-Asp Phenylalanine Met-Lys-His-lle-Pro-Phe-Phe-Phe-Ala-Phe-Phe- Phe-Thr-Phe-Pro Figure 8.20
Figure 8.20 Tryptophan Operon
Tryptophan Operon: mRNA 4 trpD→ regions 1, 2: synthesis of leader peptide regions 2, 3: form stem-loop structure regions 3, 4: form stem-loop structure
Tryptophan Operon: mRNA 1 2 3 4 trpE → • regions 1, 2: synthesis of leader peptide • regions 2, 3: form stem-loop structure • regions 3, 4: form stem-loop structure
Attenuation Tryptophan-starved: transcription not terminated Excess tryptophan: transcription terminated Leader sequence DNA Direction of Direction of transcription Translation stalled RNA 厂RNA Ribosome polymerase polymerase ontinue (terminates) Leader Tryptophan tructural Tryptophan peptide structural genes gene Trp-rich leader mRNA Direction of translation peptide Transcription terminated Figure 8.21
Figure 8.21 Attenuation
Figure 8.22 Bioluminescent Vibrio fischeri
Figure 8.22 Bioluminescent Vibrio fischeri
Vibrio bioluminescence Vibrio fischeri inhabits the open sea(in small densities), as well as in squid light organs(in high densities) Luminescence occurs only at high cell concentrations
Vibrio bioluminescence • Vibrio fischeri inhabits the open sea (in small densities), as well as in squid light organs (in high densities) • Luminescence occurs only at high cell concentrations
Quorum Sensing Regulation of genes expression in response to population density Acylated homoserine lactone(AHL) molecules might be produced and excreted by all cells in a given population Higher population density results in greater concentration of Ahl AHL molecules activate a specific transcriptional activator protein, resulting in specific transcription induction
Quorum Sensing • Regulation of genes expression in response to population density • Acylated homoserine lactone (AHL) molecules might be produced and excreted by all cells in a given population • Higher population density results in greater concentration of AHL • AHL molecules activate a specific transcriptional activator protein, resulting in specific transcription induction
Low cell density lux box ur 工工亡 3-0x0-C6-HSL High cell density ↓-R lux box c八N LUxR 3-0xO-C6-HSL Light Quorum-sensing model from University of Nottingham Quorum Sensing Research Group(Paul Williams)
Quorum-sensing model from University of Nottingham Quorum Sensing Research Group (Paul Williams)
