
Archives of Oral Biology 100(2019)23-32 Contents lists available at ScienceDirect Archives of Oral Biology ELSEVIER journalhomepagewww.elsevier.com/locate/archoralbio Force-induced decline of tea domain family member 1 contributes to osteoclastogenesis via regulation of osteoprotegerin Qian Li, Gaofeng Han, Dawei Liu, Yanheng Zhou Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology Beijing Key Laboratory of Digital Stomatology, Beijing, China ARTICLE INFO ABSTRACT bjective: This study aims to investigate the responsiveness of transcription factor Tea domain family member 1 (TEAD1) to mechanical force and its impact on osteoclastogenesis as well as expression of Osteoprotegerin TEa domain family member 1 (TEADl) PG), an inhibitor for osteoclastogenesis playing crucial roles in mechanical stress-induced bone remodeling Human periodontal ligament cell(PDLC) d orthodontic tooth movement (otm). Osteoclast differentiation Methods: We first analyzed the correlation between several transcription factors and OPG expression in human eriodontal ligament cells(PDLCs). Then dynamic expression changes of TEADI with force application nalyzed due to its high correlation with OPG Loss-of-function experiments were performed to demonstrate the role of TEADI in regulation of RANKL/OPG, as well as osteoclastogenesis by tartrate- resistant acid phosphatase (TRAP)staining. Combination of bioinformatics analyzes and chromatin immunoprecipitation assay was utilized investigate occupancy of TEADI on the enhancer elements of OPG and the dynamic change in response to force stimuli. Involvement of Hippo signaling in regulation of OPG was further demonstrated by pharmacologic hibitors of several Results: Expression of TEADI highly correlates with that of OPG and decreases in response to mechanical force in human PDLCs. Knockdown of TEADI downregulates expression of OPG and promotes osteoclast differ- entiation. Mechanical force induced decreased binding of TEADl on an enhancer element 22 kilobases upstream of OPG promoter OPG was also affected by pharmaceutical disruption of Hippo signaling pathway. Conchusions: TEADI is a novel mechano-responsive gene and plays an important role in force-induced osteo- clastogenesis, which is dependent, as least partially, on transcriptional regulation of OPG. 1. Introduction factor-kB(RANKL)/ osteoprotegerin (OPG) axis plays a pivotal role and is considered to be a rate-limiting determinant for OTM (Ya Periodontal ligament is the soft connective tissue lying betv 2009). OPG inhibits osteoclastogenesis as a decoy receptor Lacey, 2003; Simonet et al (Beertsen, McCulloch, Sodek, 1997). Periodontal ligament cells are 1997). Expression of OPG was reported to be downregulated both in mainly composed of heterogeneous fibroblasts that include osteogenic vivo and in vitro after force application. (Li et al., 2011, 2013; Li, Zhang, progenitor cells. Besides, there are cementum cells, macrophages and Wang, Li, Zhang, 2015; Nishijima et al, 2006; Toygar, Kircelli, Bulut, lymphocytes in the periodontal ligament (Jiang et al., 2016). During Sezgin, Tasdelen, 2008)Moreover, local OPG gene transfer to peri mechanical stimuli-induced orthodontic tooth movement (OTM), odontal tissue could inhibit OTM (Kanzaki et al, 2004), underlying the impressive force applied on the periodontal ligament could induce importance of oPG in osteoclastogenesis during OTM. However, up to osteoclastogenesis through secretion of a series of pro-inflammatory now, its upstream regulators responding to mechanical cues remain cytokines including interleukin 1(IL-1), interleukin 6 (IL-6), and cy. elusive clooxygenase 2(COX-2), etc. Importantly, the receptor activator of Mechanical forces are sensed primarily at integrin-extracellular clear factor-kB (RANK)/ ligand for the receptor activator of nuclear matrix and cell-cell adhesion sites at cell surface. Then the information Corresponding authors at: Department of Orthodontics, Peking University, School Hospital of Stomatology, 22 Zhongguancun South Avenue, Beijing 100081 E-mailaddresses:qianli@bjmueducn(Q.Li),yanhengzhou@vip.163.com(Y.Zhou) https://doi.org/10.1016/j.archoralbio.2019.01.020 Received 17 September 2018; Received in revised form 28 January 2019: Accepted 30 January 2019 003-9969/@ 2019 Elsevier Ltd. All rights reserved
Contents lists available at ScienceDirect Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio Force-induced decline of TEA domain family member 1 contributes to osteoclastogenesis via regulation of Osteoprotegerin Qian Li⁎ , Gaofeng Han, Dawei Liu, Yanheng Zhou⁎ Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, Beijing, China ARTICLE INFO Keywords: Osteoprotegerin (OPG) TEA domain family member 1 (TEAD1) Human periodontal ligament cell (PDLC) Osteoclast differentiation ABSTRACT Objective: This study aims to investigate the responsiveness of transcription factor TEA domain family member 1 (TEAD1) to mechanical force and its impact on osteoclastogenesis as well as expression of Osteoprotegerin (OPG), an inhibitor for osteoclastogenesis playing crucial roles in mechanical stress-induced bone remodeling and orthodontic tooth movement (OTM). Methods: We first analyzed the correlation between several transcription factors and OPG expression in human periodontal ligament cells (PDLCs). Then dynamic expression changes of TEAD1 with force application were analyzed due to its high correlation with OPG. Loss-of-function experiments were performed to demonstrate the role of TEAD1 in regulation of RANKL/OPG, as well as osteoclastogenesis by tartrate-resistant acid phosphatase (TRAP) staining. Combination of bioinformatics analyzes and chromatin immunoprecipitation assay was utilized to investigate occupancy of TEAD1 on the enhancer elements of OPG and the dynamic change in response to force stimuli. Involvement of Hippo signaling in regulation of OPG was further demonstrated by pharmacologic inhibitors of several components. Results: Expression of TEAD1 highly correlates with that of OPG and decreases in response to mechanical force in human PDLCs. Knockdown of TEAD1 downregulates expression of OPG and promotes osteoclast differentiation. Mechanical force induced decreased binding of TEAD1 on an enhancer element ˜22 kilobases upstream of OPG promoter. OPG was also affected by pharmaceutical disruption of Hippo signaling pathway. Conclusions: TEAD1 is a novel mechano-responsive gene and plays an important role in force-induced osteoclastogenesis, which is dependent, as least partially, on transcriptional regulation of OPG. 1. Introduction Periodontal ligament is the soft connective tissue lying between cementum and the alveolar bone. It plays crucial roles in providing vascular supply and nutrients, as well as maintaining bone homeostasis (Beertsen, McCulloch, & Sodek, 1997). Periodontal ligament cells are mainly composed of heterogeneous fibroblasts that include osteogenic progenitor cells. Besides, there are cementum cells, macrophages and lymphocytes in the periodontal ligament (Jiang et al., 2016). During mechanical stimuli-induced orthodontic tooth movement (OTM), compressive force applied on the periodontal ligament could induce osteoclastogenesis through secretion of a series of pro-inflammatory cytokines including interleukin 1 (IL-1), interleukin 6 (IL-6), and cyclooxygenase 2 (COX-2), etc. Importantly, the receptor activator of nuclear factor-κB (RANK)/ ligand for the receptor activator of nuclear factor-κB (RANKL)/ osteoprotegerin (OPG) axis plays a pivotal role and is considered to be a rate-limiting determinant for OTM (Yamaguchi, 2009). OPG inhibits osteoclastogenesis as a decoy receptor to prevent the interaction between RANK and its ligand RANKL in bone homeostasis and osteoporosis (Boyle, Simonet, & Lacey, 2003; Simonet et al., 1997). Expression of OPG was reported to be downregulated both in vivo and in vitro after force application. (Li et al., 2011, 2013; Li, Zhang, Wang, Li, & Zhang, 2015; Nishijima et al., 2006; Toygar, Kircelli, Bulut, Sezgin, & Tasdelen, 2008) Moreover, local OPG gene transfer to periodontal tissue could inhibit OTM (Kanzaki et al., 2004), underlying the importance of OPG in osteoclastogenesis during OTM. However, up to now, its upstream regulators responding to mechanical cues remain elusive. Mechanical forces are sensed primarily at integrin–extracellular matrix and cell–cell adhesion sites at cell surface. Then the information https://doi.org/10.1016/j.archoralbio.2019.01.020 Received 17 September 2018; Received in revised form 28 January 2019; Accepted 30 January 2019 ⁎ Corresponding authors at: Department of Orthodontics, Peking University, School & Hospital of Stomatology, 22 Zhongguancun South Avenue, Beijing 100081, China. E-mail addresses: qianli@bjmu.edu.cn (Q. Li), yanhengzhou@vip.163.com (Y. Zhou). Archives of Oral Biology 100 (2019) 23–32 0003-9969/ © 2019 Elsevier Ltd. All rights reserved. T

Archives of Oral Biology 100(2019) A B R2=09453 1.5 o.o 15 2=0.0347 0.5 00.511.522.5 Relative mRNA level of tEad1 Relative mRNA level of TEAD2 1.5 o.o 15 R2=0.285 R2=0.1975 90.5 0 00.511.522.5 00.511.522.533.5 Relative mRNA level of TEAD3 Relative mRNA level of tead4 E F 2 1.5 R2=0.5712 61.5 R2=0.15 20.5 0.5 0 Relative mRNA level of RsF Relative mRNA level of p65 Fig. 1. Expression of TEADI correlates with OPG in human PDLCs. The total mRNA of freshly isolated PDLCs from 7 donors was collected and subjected to uantitative reverse transcription PCR(RT-qPCR). The gene expression correlations between each indicated transcription factor and oPG were displayed as a scatter is transmitted through mechanosensory systems that include stretch- The Hippo cascade with established functions in organ size control activated ion channels, integrins and adherens junctions, adaptor pro- and tissue homeostasis is emerging as a mechanotransduction pathway teins such as vinculin and talins, focal adhesion kinase, and the SRC- (Meng, Moroishi, Guan, 2016; Yu, Zhao, Guan, 2015). After the family kinases that connect the extracellular mechanical world to the F. perception of mechanical strains, actin cytoskeleton a actin cytoskeleton. (Uhler Shivashankar, 2017)Notably, these me. would act on the core kinase components of Hippo pathway, including anosensory proteins and cytoskeleton remodeling could induce the Set20-like kinase 1/2(MST1/2)and the large tumor suppressor 1 changes in some signaling pathways, such as Hippo signaling cascade (LATS1/2)(Meng et al., 2016). The translation of physical cues into through interaction with its components and further cause downstream biochemical reactants through Hippo signaling thus would lead to the transcriptional changes and cellular behavioral alterations(Panciera, sequestration and degradation of Yes-associated protein(YAP)and Azzolin, Cordenons, Piccolo, 2017) transcriptional co-activator with PDZ-binding motif (TAz) in
is transmitted through mechanosensory systems that include stretchactivated ion channels, integrins and adherens junctions, adaptor proteins such as vinculin and talins, focal adhesion kinase, and the SRCfamily kinases that connect the extracellular mechanical world to the Factin cytoskeleton. (Uhler & Shivashankar, 2017) Notably, these mechanosensory proteins and cytoskeleton remodeling could induce changes in some signaling pathways, such as Hippo signaling cascade through interaction with its components and further cause downstream transcriptional changes and cellular behavioral alterations (Panciera, Azzolin, Cordenonsi, & Piccolo, 2017). The Hippo cascade with established functions in organ size control and tissue homeostasis is emerging as a mechanotransduction pathway (Meng, Moroishi, & Guan, 2016; Yu, Zhao, & Guan, 2015). After the perception of mechanical strains, actin cytoskeleton and Rho GTPases would act on the core kinase components of Hippo pathway, including the Set20-like kinase 1/2 (MST1/2) and the large tumor suppressor 1/2 (LATS1/2) (Meng et al., 2016). The translation of physical cues into biochemical reactants through Hippo signaling thus would lead to the sequestration and degradation of Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) in Fig. 1. Expression of TEAD1 correlates with OPG in human PDLCs. The total mRNA of freshly isolated PDLCs from 7 donors was collected and subjected to quantitative reverse transcription PCR (RT-qPCR). The gene expression correlations between each indicated transcription factor and OPG were displayed as a scatter plot, respectively. (n = 3). Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 24

Archives of Oral Biology 100(2019)23-32 cytoplasm, and such inactivation will eventually lead to the cessation of concentration 2 HM), and the YAP/TaZ activity inhibitor verteporfin transcription of their target gene(Meng et al., 2016). When these two (Med Chem Express) transcriptional coactivators are shuttled into nucleus, they could in- teract with the TEa domain (TEAD) family transcription factors to 2. 2. Flow cytometry analyses regulate a broad spectrum of downstream genes with diverse roles in self-renew of stem cell, cell proliferation and fate determination Cells were washed with PBS, detached with 0. 25% trypsin, (Zanconato, Cordenons, Piccolo, 2016) with 75% ethanol overnight. After treatment with 1 mg/ml In mammals, four highly conserved TEAD transcription factors have (Sigma)at 37'C for 30 min, cells were resuspended in 0.5 ml of been identified as TEAD1, TEAD2, TEAD3 and TEAD4 (Xiao, Davidson, stained with propidium iodide in the dark for 30 min Fluorescence was Matthes, Garnier, Chambon, 1991). Though TEADs can be detected in measured with a flow cytometry system(BD Biosciences). The cell cy- almost any eukaryotes, Kaneko DePamphilis, 1998) their expression cles were analyzed using the Modfit software. patterns are distinct and each of them has a unique function in con- trolling both physiologic processes and oncogenic malignancies 2.3. Co-culture of PDLcs and RAw 264.7 or human peripheral blood Jacquemin et al, 1998; Kaneko, Cullinan, Latham, DePamphilis, mononuclear cells(PBMCs)and TRAP staining 1997; Zhou et al, 2016). Moreover, though TEADs' function as tran- scription factors require interaction with coactivators such as YAP/TAZ PDLCs were seeded into 6-well plates and transfected with siRNAs and p160, aberrant transcriptional levels of TEADs are found in various against TEADI or the non-sense control siRNA. Then the cells were types of cancer which correlate with poor clinical outcome(Pobbati subjected to compressive force of 1.5 g/cm for 24 h, and RAW264.7 Hong, 2013), indicating the important role of TEADs in cell functional cells were added to the well. After 7 days, the cells were fixed and naintenance. In addition, YAP/TAZ has been reported to be involved in stained for TRAP staining using acid phosphatase kit (387 A, Sigma). regulation of osteoblast and osteoclast differentiation, though the TRAP-positive multinucleated osteoclasts were counted in 5 visual conclusions are still controversial (Hong et al., 2005; Kegelman et al., fields in each well (n= 3). We calculated the average value of 3 ex- 2018; Zaidi et al., 2004), raising the possibility that Hippo signaling periments. Human PBMCs were primarily derived from periphery might also be involved in mechanical stress-induced bone remodeling blood. Then the PBMCs were co-cultured with PDLCs and subjected to process. Therefore, we believe it necessary to investigate whether TRAP staining 21 days later TEADs family and YAP/TAZ could transcriptionally respond to me. chanical stress and mediate downstream target genes regulation re- 2. 4. Fractionation, western blotting analyses and antibodies garding osteoclast differentiation. In this study, we identified TEADI as a novel mechano re Cultured cells were harvested after washing with ice-cold phos- gene in human PDLCs. We showed that TEAD1 decreased upon force phate-buffered saline and then lysed in extraction buffer(50 mM Tris- stimuli, correlating with the expression of OPG. Loss-of-function ex- HCl, PH 8.0. 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet p-40, 0.01% periments indicated TEADl-mediated regulation of RANKL/OPG and protease inhibitor mixture) Cells were fractionated using Nuclease and osteoclastogenesis of co-cultured RAW264.7 cells. We further dissected Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, MA, USA), the molecular basis for TEADI's function with physical cues induced according to the manufacturer's protocol. dynamic binding on a distal enhancer element of OPG in human PDLCs. estern blotting analyses were performed as previously described (Zhang et aL, 2016). Antibodies used are as follows: anti-TEAD 2. Materials and methods (13283-1-AP, Proteintech); anti-OPG (ab11994, Abcam); anti-glycer aldehyde- 3-phosphate dehydrogenase (GAPDH)(sc-47724, Santa 2.1. Cell lines, cell culture and treatments Cruz): anti-RANKL (ab45039, Abcam); anti-Phospho-YAP(Ser127) Human PDLCs were isolated from PDL of normal orthodontic ex- (Ser397)(#13619, CST), anti-YAP/TAZ (#8418, CST); anti-B-actin tracted bicuspid, according to previously reported protocols with slight (#3700, CST); anti-lamin A/C (#4777, CST). modification (Iwata et aL, 2010; Zheng et al, 2009). Tissues were ob- tained under approved guidelines set by Peking University Ethical 2.5. siRNA transfection, plasmid transfection and quantitative reverse. Committee with informed donor consent. Briefly, the PDL tissues of 7 transcription polymerase chain reaction(qRT-PCR) donors were separated from the mid-third of the root surface and minced into small tissue cubes. Subsequently, the tissue cubes were Two double-stranded siRNAs against TEADI and the scrambled digested with a solution of 3 mg/mL collagenase(type D) with 4 mg/mL control siRNA (siNC) were chemically synthesized(GenePharma). The dispase(both from Sigma-Aldrich) in a-minimum essential medium(a- sequences of siRNA are as follows: siTEADl-1: CGATUUGUAUACCGA clone) for 15 AUAA: siTEAD1-2: GAAAGGUGGCUUAAAGGAA. Transfection of explants were then plated into culture dishes containing a-MEM sup- siRNa was performed using the Lipofectamin RNAiMAX (Invitrogen) Itamine(Hyclone), 100 units/mL penicillin streptomycin(Hycloy F plemented with 10% fetal bovine serum(FBS; Hyclone), 0.292 mg/m following the manufacturer's instruction The TEADl overexpression plasmid pRK5-Myc-TEADl and the and 100 mM/L ascorbic acid(Sigma-Aldrich) and incubated at 37C in empty control vector pRKS were purchased from Addgene Transfection a humidified atmosphere containing 5%CO2 Cells were used in this of plasmid was performed using Lipofectamine LTX (Invitrogen) fol- study with 4 to 6 passages In Figs. 2-5, PDLCs isolated from 3 of the 7 lowing the manufacturers instruction. individuals were pooled together and used. Total RNAs were extracted from PDLCs using Trizol reagent a, Static compressive force was applied as previously described. (Invitrogen). Synthesis of first strand cDNA and subsequent quantitative Mitsui et al., 2005)A layer of glass cover and additional metal weights PCR were performed as previously described. All qRT-PCR processes were placed on top of an 80% confluent cell layer in 6-well plates. Cells were performed three times using GAPDH as the internal control. The were subjected to different continuous compressive forces ranging from primers used in this study are as listed below: GAPDH forward (F): 0 to 1.5g/cm2 for 24h(h)or at 1.5g/cm'for different durations ran. caatgaccccttcattgacc, GAPDH reverse(R): atgacaagcttcccgttctc: RANKL ging from 0 to 24h. F: ATCACAGCACATCAGAGCAGAGA, RANKL R: AGGACAGACTCACT To evaluate the influence of Hippo signaling on OPG expression, the TTATGGGAAC; oPG F: gaggcattcttcaggtttge, OPG R nhibitors were used in this study: the JNK inhibitor gctgtgttgccgttttatcc; TEADI F: cttgccagaaggaaatctcg, TEAD1 R: SP600125(Selleck), the MST1/2 inhibitor XMU-MP-1(Selleck, final ccccagcttgttatgaatgg: TEAD2 F: ttttggtctggaggatctgg, TEAD2 R:
cytoplasm, and such inactivation will eventually lead to the cessation of transcription of their target gene (Meng et al., 2016). When these two transcriptional coactivators are shuttled into nucleus, they could interact with the TEA domain (TEAD) family transcription factors to regulate a broad spectrum of downstream genes with diverse roles in self-renew of stem cell, cell proliferation and fate determination (Zanconato, Cordenonsi, & Piccolo, 2016). In mammals, four highly conserved TEAD transcription factors have been identified as TEAD1, TEAD2, TEAD3 and TEAD4 (Xiao, Davidson, Matthes, Garnier, & Chambon, 1991). Though TEADs can be detected in almost any eukaryotes,(Kaneko & DePamphilis, 1998) their expression patterns are distinct and each of them has a unique function in controlling both physiologic processes and oncogenic malignancies (Jacquemin et al., 1998; Kaneko, Cullinan, Latham, & DePamphilis, 1997; Zhou et al., 2016). Moreover, though TEADs’ function as transcription factors require interaction with coactivatiors such as YAP/TAZ and p160, aberrant transcriptional levels of TEADs are found in various types of cancer which correlate with poor clinical outcome (Pobbati & Hong, 2013), indicating the important role of TEADs in cell functional maintenance. In addition, YAP/TAZ has been reported to be involved in regulation of osteoblast and osteoclast differentiation, though the conclusions are still controversial (Hong et al., 2005; Kegelman et al., 2018; Zaidi et al., 2004), raising the possibility that Hippo signaling might also be involved in mechanical stress-induced bone remodeling process. Therefore, we believe it necessary to investigate whether TEADs family and YAP/TAZ could transcriptionally respond to mechanical stress and mediate downstream target genes regulation regarding osteoclast differentiation. In this study, we identified TEAD1 as a novel mechano-responsive gene in human PDLCs. We showed that TEAD1 decreased upon force stimuli, correlating with the expression of OPG. Loss-of-function experiments indicated TEAD1-mediated regulation of RANKL/OPG and osteoclastogenesis of co-cultured RAW264.7 cells. We further dissected the molecular basis for TEAD1′s function with physical cues induced dynamic binding on a distal enhancer element of OPG in human PDLCs. 2. Materials and methods 2.1. Cell lines, cell culture and treatments Human PDLCs were isolated from PDL of normal orthodontic extracted bicuspid, according to previously reported protocols with slight modification (Iwata et al., 2010; Zheng et al., 2009). Tissues were obtained under approved guidelines set by Peking University Ethical Committee with informed donor consent. Briefly, the PDL tissues of 7 donors were separated from the mid-third of the root surface and minced into small tissue cubes. Subsequently, the tissue cubes were digested with a solution of 3 mg/mL collagenase (type I) with 4 mg/mL dispase (both from Sigma-Aldrich) in α-minimum essential medium (α- MEM, Hyclone) for 15 min at 37 °C with vigorous shaking. The tissue explants were then plated into culture dishes containing α-MEM supplemented with 10% fetal bovine serum (FBS; Hyclone), 0.292 mg/mL glutamine (Hyclone), 100 units/mL penicillin streptomycin (Hyclone), and 100 mM/L ascorbic acid (Sigma-Aldrich) and incubated at 37 °C in a humidified atmosphere containing 5% CO2. Cells were used in this study with 4 to 6 passages. In Figs. 2–5, PDLCs isolated from 3 of the 7 individuals were pooled together and used. Static compressive force was applied as previously described. (Mitsui et al., 2005) A layer of glass cover and additional metal weights were placed on top of an 80% confluent cell layer in 6-well plates. Cells were subjected to different continuous compressive forces ranging from 0 to 1.5 g/cm2 for 24 h (h) or at 1.5 g/cm2 for different durations ranging from 0 to 24 h. To evaluate the influence of Hippo signaling on OPG expression, the following inhibitors were used in this study: the JNK inhibitor SP600125 (Selleck), the MST1/2 inhibitor XMU-MP-1 (Selleck, final concentration 2 μM), and the YAP/TAZ activity inhibitor verteporfin (MedChemExpress). 2.2. Flow cytometry analyses Cells were washed with PBS, detached with 0.25% trypsin, and fixed with 75% ethanol overnight. After treatment with 1 mg/ml RNase A (Sigma) at 37 °C for 30 min, cells were resuspended in 0.5 ml of PBS and stained with propidium iodide in the dark for 30 min. Fluorescence was measured with a flow cytometry system (BD Biosciences). The cell cycles were analyzed using the Modfit software. 2.3. Co-culture of PDLCs and RAW 264.7 or human peripheral blood mononuclear cells (PBMCs) and TRAP staining PDLCs were seeded into 6-well plates and transfected with siRNAs against TEAD1 or the non-sense control siRNA. Then the cells were subjected to compressive force of 1.5 g/cm2 for 24 h, and RAW264.7 cells were added to the well. After 7 days, the cells were fixed and stained for TRAP staining using acid phosphatase kit (387 A, Sigma). TRAP-positive multinucleated osteoclasts were counted in 5 visual fields in each well (n = 3). We calculated the average value of 3 experiments. Human PBMCs were primarily derived from periphery blood. Then the PBMCs were co-cultured with PDLCs and subjected to TRAP staining 21 days later. 2.4. Fractionation, western blotting analyses and antibodies Cultured cells were harvested after washing with ice-cold phosphate-buffered saline and then lysed in extraction buffer (50 mM TrisHCl, pH 8.0. 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet p-40, 0.01% protease inhibitor mixture). Cells were fractionated using Nuclease and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, MA, USA), according to the manufacturer’s protocol. Western blotting analyses were performed as previously described (Zhang et al., 2016). Antibodies used are as follows: anti-TEAD1 (13283-1-AP, Proteintech); anti-OPG (ab11994, Abcam); anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sc-47724, Santa Cruz); anti-RANKL (ab45039, Abcam); anti-Phospho-YAP (Ser127) (#13008, Cell Signaling Technology, (CST)); anti-Phospho-YAP (Ser397) (#13619, CST), anti-YAP/TAZ (#8418, CST); anti-β-actin (#3700, CST) ; anti-lamin A/C (#4777, CST). 2.5. siRNA transfection, plasmid transfection and quantitative reversetranscription polymerase chain reaction (qRT-PCR) Two double-stranded siRNAs against TEAD1 and the scrambled control siRNA (siNC) were chemically synthesized (GenePharma). The sequences of siRNA are as follows: siTEAD1-1: CGATUUGUAUACCGA AUAA; siTEAD1-2: GAAAGGUGGCUUAAAGGAA. Transfection of siRNA was performed using the Lipofectamin RNAiMAX (Invitrogen) following the manufacturer’s instruction. The TEAD1 overexpression plasmid pRK5-Myc-TEAD1 and the empty control vector pRK5 were purchased from Addgene. Transfection of plasmid was performed using Lipofectamine LTX (Invitrogen) following the manufacturer’s instruction. Total RNAs were extracted from PDLCs using Trizol reagent (Invitrogen). Synthesis of first strand cDNA and subsequent quantitative PCR were performed as previously described. All qRT-PCR processes were performed three times using GAPDH as the internal control. The primers used in this study are as listed below: GAPDH forward (F): caatgaccccttcattgacc, GAPDH reverse (R): atgacaagcttcccgttctc; RANKL F: ATCACAGCACATCAGAGCAGAGA, RANKL R: AGGACAGACTCACT TTATGGGAAC; OPG F: gaggcattcttcaggtttgc, OPG R: gctgtgttgccgttttatcc; TEAD1 F: cttgccagaaggaaatctcg, TEAD1 R: ccccagcttgttatgaatgg; TEAD2 F: ttttggtctggaggatctgg, TEAD2 R: Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 25

Archives of Oral Biology 100(2019) B 00511.5(g/cm2) 061224(h) 061224(h) TEAD1 TEAD1 GAPDH GAPDH RANKL GAPDH 51 0.8 0.8 0.8 0.6 0.6 0 0 061224(h) 15(g/cm2) 061224(h) 12 1.2 8 0.8 000 1 0.6 0.4 0.2 061224(h) 061224(h) .zgo Fig. 2. Compressive force decreases expressions of TEADl in human PDLCs. (A)Forces with different intensity induced downregulation of TEADl. PDLCs were treated with increasing force intensity for 24 h, followed by total proteins and mRNA extraction. Expression changes of TEADI were determined by western blot(top and middle) and qRT-PCR (bottom), respectively. (B) Force induced downregulation of TEADI in a time-dependent manner. PDLCs were treated with varying durations at 1.5 g/cm2 force, followed by total proteins and mRNA extraction. Ex changes of TEADI were determined by western blot(top and middle)and qRT-PCR(bottom), respectively. (C) Protein levels of RANKL and OPG changed with force application. Western blotting analysis of RANKL and OPG in PDLCs exposed to compressive force of 1.5 g/cm- for prolonged time durations(F). GAPDH serves as a loading control. Data represent mean t SD from three independent experiments. P
atgggggagtcagtgacaag ; TEAD3 F: agatgtacggccgaaatgag, TEAD3 R: ttttctcgtccgagtcttcc; TEAD4 F: tcatccacaagctcaagcac TEAD4 R: tcatccacaagctcaagcac; SRF F: Gccactggctttgaagagac, SRF R: tgctaggtgctgtttggatg; NF-ƙB subunit p65 F: Tgggaatccagtgtgtgaag, p65 R: aaggggttgttgttggtctg. IL-6 F: aggcactggcagaaaacaac, IL-6 R: ttttcaccaggcaagtctcc; IL-1 F: tgcctgagatacccaaaacc, IL-1 R: gtttggatgggcaactgatg; colony stimulating factor 1(M-CSF) F: ttgtcaaggacagcaccatc, MCSF R: ttctgggacccaattagtgc; m (mouse) c-fos F: agaaacggagaatccgaagg, mc-fos R: tgcaacgcagacttctcatc; m nuclear factor of activated T cells 1 (Nfatc1) F: tgggagatggaagcaaagac, mNfatc1 R: ttgcggaaaggtggtatctc; mgapdh F: aacgaccccttcattgacctc, mgapdh R: actgtgccgttgaatttgcc. 2.6. Bioinformatics analysis The genome-wide DNase I sensitivity data for periodontal ligament cells was retrieved from the ENCODE project (Consortium, 2012). We used homer (Heinz et al., 2010) software to scan the whole genome for TEAD motifs. 2.7. Chromatin immunoprecipitation assay Chromatin immunoprecipitation assay was performed using the SimpleChIP Enzymatic Chromatin IP (Immunoprecipitation) Kit (#9002, CST) according to manufacturer’s instruction. The antibody used was TEAD1 (#12292, CST). The precipitated DNA was quantified by qPCR using primers, which were designed according to the 5 regions Fig. 2. Compressive force decreases expressions of TEAD1 in human PDLCs. (A) Forces with different intensity induced downregulation of TEAD1. PDLCs were treated with increasing force intensity for 24 h, followed by total proteins and mRNA extraction. Expression changes of TEAD1 were determined by western blot (top and middle) and qRT-PCR (bottom), respectively. (B) Force induced downregulation of TEAD1 in a time-dependent manner. PDLCs were treated with varying durations at 1.5 g/cm2 force, followed by total proteins and mRNA extraction. Expression changes of TEAD1 were determined by western blot (top and middle) and qRT-PCR (bottom), respectively. (C) Protein levels of RANKL and OPG changed with force application. Western blotting analysis of RANKL and OPG in PDLCs exposed to compressive force of 1.5 g/cm2 for prolonged time durations (F). GAPDH serves as a loading control. Data represent mean ± SD from three independent experiments. *P < 0.05. (n = 3). Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 26

Archives of Oral Biology 100(2019) B SiNC SiTEAD1-1 SiTEAD1-2 1.6 TEAD1 1.2 100 RANKL GAPDH 0.2 直直 0 TEAD1 OPG RANKL ■ SITEAD1-1 2.5 12sNc■ SITEAD1-1■ SITEAD1-2 2 SITEAD1-2 5 5 Vector TEAD NFAtc-1 SiNC SiTEAD1-1 SiTEAD1-2 显4 3 2 1 0 Nc SiTEAD1-1 SiTEAD1-2 2 考 (caption on next page) potentially bound by TEADl as uncovered by bioinformatics analysis: GCTCATGTTCTCCAAGG; primerS: TGGGAGTGTTGGCTTTTAGG. primerlF: TGCCTAATGCTGTTGACTGG; primerIR: TTCCATCTGGTGG TGGAAAG; primer2F: TTCCACTTTGTGGTGAGGTG; primer2R: AAAA 2.8. Statistical analyses GAGATGGTGCCCAACC; primer3 F: GTGACTGCAAGGGCATTTTAC primer 3R: GCGTCTTTAGTTGTGGACTGG; primer4F: TGTGCTTGTGTC All the data were presented as mean t standard deviation(SD)of TCCTCCAC; primer4R: TCTGGGACACACTCCAACTG; primers F: TGA three independent experiments. Statistical analysis was performed
potentially bound by TEAD1 as uncovered by bioinformatics analysis: primer1F: TGCCTAATGCTGTTGACTGG; primer1R: TTCCATCTGGTGG TGGAAAG; primer2F: TTCCACTTTGTGGTGAGGTG; primer2R: AAAA GAGATGGTGCCCAACC; primer3 F: GTGACTGCAAGGGCATTTTAC; primer3R: GCGTCTTTAGTTGTGGACTGG; primer4F: TGTGCTTGTGTC TCCTCCAC; primer4R: TCTGGGACACACTCCAACTG; primer5 F: TGA GCTCATGTTCTCCAAGG; primer5R: TGGGAGTGTTGGCTTTTAGG. 2.8. Statistical analyses All the data were presented as mean ± standard deviation (SD) of three independent experiments. Statistical analysis was performed (caption on next page) Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 27

Archives of Oral Biology 100(2019) Fig. 3. TEADI knockdown results in decreased expression of OPG, as well as promoted osteoclast differentiation. (A-B) Knockdown of TEADl by siRNA led to regulation of OPG PDLCs were transfected with two independent siRNAs against TEADI(siTEADI-l, siTEADI-2),or control siRNA(siNC). Then ing (A)and qR analyses(B)of indicated upregulated OPG expression PDLCs were transfected with the plasmid overexpressing TEADI (TEAD1), or the empty control vector extracted and subjected to qRT-PCR analysis of OPG expression. (D) Knockdown of TEADl had no effect on the expression of IL-1, IL-6 and M-CSF PDLCs w transfected with siRNA as in (A)and subjected to qRT-PCR analysis. (E)Knockdown of TEADI in PDLCs promoted activation of co-cultured RAW264.7 cells. RAW264.7 cells were co-cultured with supernatants from PDLCs transfected with siRNAs against TEAD1 (siTEADl-l, siTEAD1-2)or non-sense control (siNC) followed by force stimulation for 24 h 3 days later, RAW 264.7 cells were harvested and subjected to qRT-PCR analyses for expression of c-fos and NFAtc-1(F-G) TEADI knockdown promoted force- induced osteoclast differentiation in co-culture systems. PDLCs were transfected with siRNA as in(A), followed by 24 h's force application at 1.5g/cm2 and subsequent co-culture with RAW264. 7(F)or human PBMCs(G )for 7 or 21 days. Then cells were subjected to TRAP staining. Scale bar: 100 um. Data represent mean SD from three independent experiments (n= 3)*P
using Student t-test or one-way analysis of variance (ANOVA). P values are specified in the relevant figure legend. Statistical significance was considered at P < 0.05. 3. Results 3.1. Correlated down-regulation of OPG and TEAD1 expressions in response to compressive force As stated above, OPG has been well recognized as a critical inhibitor for osteoclastogenesis with extensive implications in mechanical cues induced orthodontic tooth movement (Yamaguchi, 2009), yet little molecular insight on its upstream linkage toward known mechanosignaling pathways has been documented. To address this, we collected periodontal ligament cells (PDLCs) from 7 donors (Q. Li, Ma, Zhu, Zhang, & Zhou, 2017), and extracted their mRNA to test the expression correlation between OPG and a panel of transcription factors with established mechanotransduction functions such as serum response factor (SRF), p65 in nuclear factor-κB (NF-κB) pathway (Mendez & Janmey, 2012), TEAD1, TEAD2, TEAD3 and TEAD4 in Hippo pathway. The mRNA levels were measured by quantitative reverse transcription PCR (qRT-PCR), and the statistical analysis revealed a significant expression correlation between OPG and TEAD1 compared to other candidates (Fig. 1A-F). To further probe the expression changes of OPG and TEAD1 in response to physical strains, we then exposed the PDLCs to compressive mechanical stress ranging from 0 to 1.5 g/cm2 . Western blotting results indicated that when the external force was applied stronger, the protein level of TEAD1 decreased to a lower extent (Fig. 2A, top and middle panels). qRT-PCR results revealed a consistent decline of their mRNA levels (Fig. 2A, bottom panel). A time-course analysis for their protein and mRNA expression changes further consolidated this point, since Fig. 3. TEAD1 knockdown results in decreased expression of OPG, as well as promoted osteoclast differentiation. (A–B) Knockdown of TEAD1 by siRNA led to downregulation of OPG. PDLCs were transfected with two independent siRNAs against TEAD1 (siTEAD1-1, siTEAD1-2), or the non-sense control siRNA (siNC). Then cells were harvested for western blotting (A) and qRT-PCR analyses (B) of indicated genes. GAPDH serves as a loading control. (C) Overexpression of TEAD1 upregulated OPG expression. PDLCs were transfected with the plasmid overexpressing TEAD1 (TEAD1), or the empty control vector (Vector). Then mRNA was extracted and subjected to qRT-PCR analysis of OPG expression. (D) Knockdown of TEAD1 had no effect on the expression of IL-1, IL-6 and M-CSF. PDLCs were transfected with siRNA as in (A) and subjected to qRT-PCR analysis. (E) Knockdown of TEAD1 in PDLCs promoted activation of co-cultured RAW264.7 cells. RAW264.7 cells were co-cultured with supernatants from PDLCs transfected with siRNAs against TEAD1 (siTEAD1-1, siTEAD1-2) or non-sense control (siNC), followed by force stimulation for 24 h. 3 days later, RAW 264.7 cells were harvested and subjected to qRT-PCR analyses for expression of c-fos and NFAtc-1. (F–G) TEAD1 knockdown promoted force-induced osteoclast differentiation in co-culture systems. PDLCs were transfected with siRNA as in (A), followed by 24 h’s force application at 1.5 g/cm2 and subsequent co-culture with RAW264.7 (F) or human PBMCs (G) for 7 or 21 days. Then cells were subjected to TRAP staining. Scale bar: 100 μm. Data represent mean ± SD from three independent experiments. (n = 3) *P < 0.05. Fig. 4. Identification of a distal enhancer occupied by TEAD1 at the OPG locus. (A) Schematic representation of DNase I sensitivity data surrounding the OPG locus from two replicates of periodontal ligament cells. The data was retrieved from the ENCODE project (Consortium, 2012). TEAD binding motif was predicted by use of homer software (Heinz et al., 2010). (B) Chromatin immunoprecipitation assay coupled with quantitative PCR was performed in PDLCs. Enrichment of TEAD1 on the five candidates from (A) was determined. (C) TEAD1′s occupation on the distal enhancer decreases with force application. PDLCs were exposed to compressive force of 1.5 g/cm2 for 24 h. Enrichment of TEAD1 on the indicated element in the unstrained (Control) or strained cells (Force) was determined using chromatin immunoprecipitation assay. Data represent mean ± SD from three independent experiments. (n = 3) *P < 0.05. Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 28

Archives of Oral Biology 100(2019) 100% S nuclea Cytoplasmic d80% ■G2M 011.5(g/cm 0115(g/cm2) H GO/G1 YAP 七一纓三三 LamA〓 20% 1.5(g/cm2) YAP1(127) 0.9 p-YAP1(S397) 1.5 GAPDH 器0.5 sP600125002550(μM) F 1.6 o>O6>0zY日 12 04 £0 0 0.5uM 1uM 1.5uM 2uM 00.5uM 1uM A 1.5UM 2WM G Verteporfin 0 0.5 1 1.5 2(]M) OPG TEAD1 GAPDH (caption on next page)
(caption on next page) Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 29

Q. Li, et al Archives of Oral Biology 100(2019)23-32 for 24. The percentages of and in the , 2010), we finally obtained five a 200 kilobases window sur- The re- 3.2.TEA of human (Fig.3 contributed to 3.3. Occupat with force a transcriptional re inding site of binding sites are probed by their hig advantage of the g ENCODE(Consortium, 2012) p et gene periodontal ligament cells regulatory elements in the OP
their inhibition by mechanical strains was more prominent when the force were applied for a longer time (Fig. 2B). We also observed the elevated RANKL, and declined OPG expression induced by compressive force (Fig. 2C), implying a high correlation between TEAD1 and OPG in response to compressive force. 3.2. TEAD1 regulates OPG expression and osteoclast differentiation Having established the correlation between TEAD1 and OPG in both unstressed and force-stressed conditions, we speculated that TEAD1 might modulate expression of OPG via functioning as a bone fide transcription factor for OPG. If so, we could expect that OPG expression would decrease in the unstrained PDLCs when TEAD1 is depleted. Indeed, after transfection of PDLCs with two independent siRNAs against TEAD1 or control siRNA, we observed that the expression of OPG in TEAD1 depleted cells was significantly lower than that in the control cells at both protein level and mRNA level (Fig. 3A, B). However, the expression of RANKL was not affected (Fig. 3A, B). Conversely, overexpression of TEAD1 led to increased OPG expression in the unstrained cells (Fig. 3C). These data suggested that knockdown of TEAD1 suppressed OPG expression, whereas overexpression of it promoted OPG expression. Besides RANKL/OPG, there are other pro-in- flammatory cytokines which play important roles in osteoclast differentiation, such as colony stimulating factor 1(M-CSF), IL-1, IL-6, etc. qPCR results indicated that knockdown of TEAD1 had no significant impact on expression of these genes, underlying the specific regulation of OPG by TEAD1 (Fig. 3D). Given the critical role of OPG in bone resorption during OTM, we next explored whether TEAD1 could play a role in regulating forceinduced osteoclastogenesis. To this end, PDLCs were first transfected with siRNA against TEAD1, and then exposed to compressive loading, followed by co-culture with the murine macrophage cell line RAW264.7. As shown in Fig.3E, knockdown of TEAD1 in force-stimulated PDLCs upregulated the expression of osteoclast marker genes c-fos and NFATc1 in co-cultured RAW264.7 cells. More importantly, the numbers of TRAP positive osteoclasts in the two groups with TEAD1 knockdown (siTEAD1-1,-2) were significantly higher than that of control group (siNC) (Fig. 3F). To consolidate this point, we took advantage of human PBMCs and co-cultured them with PDLCs. The results of TRAP staining kept in accordance with that of the RAW264.7 cells (Fig. 3G). These results indicated that force-induced decline of TEAD1 contributed to osteoclastogenesis in co-culture systems. 3.3. Occupation of TEAD1 on a distal enhancer at the OPG locus decreases with force application To thoroughly delineate the molecular basis for TEAD1-mediated transcriptional regulation of OPG, we next sought to determine the binding site of TEAD1 on the OPG locus. Since transcription factor binding sites are enriched in open chromatin context, which can be probed by their high sensitivity to DNase I digestion, we thus took advantage of the genome-wide DNase I sensitivity data from the ENCODE (Consortium, 2012) project for its epigenomic annotations of periodontal ligament cells to narrow down the number of possible regulatory elements in the OPG locus. With further restriction using TEAD motif information (Heinz et al., 2010), we finally obtained five potential TEAD bound enhancers in a ˜200 kilobases window surrounding the OPG locus (Fig. 4A). We then performed chromatin immunoprecipitation assay to examine the enrichment pattern of TEAD1 on these candidates. The results in unstrained PDLCs revealed that the site ˜22 kilobases from OPG transcription start site was a genuine TEAD1 bound element compared to a negative control region and other candidates (Fig. 4B). Furthermore, in line with the decreased OPG expression in response to physical cues (Fig. 2), application of compressive force resulted in the deceased binding of TEAD1 at this site (Fig. 4C). From these results, it can be proposed that compressive force induced declined binding of TEAD1 on the enhancer element of OPG, leading to transcriptional downregulation of OPG. 3.4. Hippo signaling pathway is involved in regulation of OPG TEAD1 is one of the major nuclear effectors in Hippo signaling cascade (Meng et al., 2016). Given the critical function of Hippo pathway in mechanosignaling, we hypothesized that Hippo signaling might be affected by compressive force and participate in regulation of downstream biological events such as proliferation and osteoclastogenesis. Flow cytometry analyses suggested that compressive force suppressed the PDLCs’ proliferation, as manifested by elevated percentage of G0/G1 PDLCs and decreased S phase cells along with increased force intensity (Fig. 5A). This raised the possibility that compressive force led to changes in YAP/TAZ activity thereby retarded the cells’ growth. Indeed, fractionation experiment demonstrated the forceinduced downregulation of YAP/TAZ both in the nucleus and the cytoplasm. (Fig. 5B) We then asked whether inactivation of key Hippo components or inhibition of its upstream c-Jun N-terminal kinase (JNK) could impair the responsiveness of OPG to physical cues. For this purpose, PDLCs were treated with JNK specific inhibitor SP600125 prior to exposure to compressive force loading. By comparison of the qRT-PCR results in strained versus unstrained cells, we observed that, contrary to the significantly decreased expression of OPG in Hippo-proficient cells, such downregulation was severely blunted in PDLCs treated with increasing dosage of SP600125 (Fig. 5C). Next, we examined the alteration of OPG in PDLCs treated with XMU-MP-1, which has been shown to be able to block MST1/2 kinase activity, and reduce the phosphorylation of endogenous MOB kinase activator 1 A (MOB1), LATS1/2 and YAP (Fan et al., 2016). Western blot analysis demonstrated the prominent reduction of YAP phosphorylation by XMU-MP-1, while protein level of OPG was inversely elevated (Fig. 5D), underlying the negative regulation of Hippo signaling on OPG expression. As the nuclear effector of Hippo signaling, TEAD family transcription factors function critically relying on recruitment of YAP/TAZ during mechanotransduction. So it can be postulated that inhibition of YAP/TAZ activity would impair the transcription of downstream target genes of TEADs including OPG. To testify this point, we treated PDLCs with increasing dosage of verteporfin, a specific inhibitor of YAP/TAZ activity capable of disrupting the association between YAP/TAZ and TEADs (Liu-Chittenden et al., 2012). As the well-recognized target gene of YAP/TAZ, cellular communication network factor 1 (CCN1, CYR61) expression showed profound decrease upon verteporfin administration, Fig. 5. Hippo signaling pathway regulates OPG expression. (A) Flow cytometry analysis of PDLCs subjected to increased force intensity for 24 h. The percentages of cells in each phase were shown as average from 3 independent experiments. (B) Compressive force decreased expression of YAP/TAZ both in the nucleus and in the cytoplasm. PDLCs were exposed to increasing force intensity for 24 h, and then the cells were harvested and subjected to nuclear and cytoplasmic lysates fractionation and western blotting analyses. Lamin A/C and β-actin served as loading controls of nuclear and cytoplasmic proteins, respectively. (C) SP600125 attenuated force-induced reduction of OPG. PDLCs were treated with JNK-specific inhibitor SP600125 at indicated concentrations for 24 h. The cells were then exposed to compressive force of 1.5 g/cm2 for 6 h. The mRNA level of OPG was measured by qRT-PCR. (D) OPG expression was promoted by administration of XMU-MP-1. PDLCs were treated with MST1/2-specific inhibitor XMU-MP-1 for 48 h. The protein level of OPG and phosphorylated YAP1 (p-YAP1(S127), p-YAP1(S397)) were determined by western blot. (E–G) OPG was repressed by administration of Verteporfin. PDLCs were administered with increasing dosage of Verteporfin for 48 h. Then total cell lysates and mRNA were extracted and subjected to qRT-PCR analysis (E, F) and western blotting (G), respectively. GAPDH served as a loading control. Data represent mean ± SD from three independent experiments. (n = 3) *P < 0.05. Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 30

Q. Li, et al Archives of Oral Biology 100(2019)23-32 indicating that YAP/TAZ activity was effectively inhibited (Fig 5E). As cell matrix stiffness, cell geometry, cell density, cell adhesion and the expected, the expression of OPG was also downregulated along with external n togenesis no conflict of interest related to the study, acquired and analyzed the data, drafted al approval of the version to be submitted. quisition of data, revised the paper f the version to be submitted. sis and interpretation of data, revised t intellectual content, and gave final to conception of the study, revised the ortant intellectual content, and gave final ap- ed by the National Natural Science hina(81502345 to Qian Li, and 81470717 to Yanheng ort no conflicts of interest related to this study. scitelli, E., Marco,.., Tonelli, D.. (2015). linical Cases in Mineral and Bone Metabolism, al ligament: A unique, on and acti- of DNA elements in the human A elements in the human ing, A. -. Kolligs, F. T. stance to TRAIL-induced h14(15),4713-4718. ym-,&tkac,(2018) esence and severity of per itus.as.7(2,131-135 might also b D.(2016 pair an P naling pathway responsive to di 8(352), 352ra108. tissue repair and
indicating that YAP/TAZ activity was effectively inhibited (Fig. 5E). As expected, the expression of OPG was also downregulated along with verteporfin administration, even to a greater extent than CYR61 (Fig. 5F, G). The administration of verteporfin also inhibited TEAD1 expression, similar with reports in the cancer cell lines (Wei et al., 2017). These results demonstrated that transcription of OPG was inhibited by blockage of YAP/TAZ activity. 4. Discussion OTM is featured as an alveolar bone remodeling process. On the tension side, new bones are formed by the osteoblasts; while bone resorption occurs by the osteoclasts on the compression side (Baloul, 2016). The osteoclast differentiation is initiated by RANKL secreted by osteoblasts. Binding of RANKL on RANK recruits the adaptor protein TNF receptor associated factor 6 (TRAF6), leading to activation of downstream signaling cascades including protein kinases-mediated NF- κB and AP-1 transcription factor C-FOS, as well as activation of mitogen activated protein kinases (MAPKs) such as c-Jun N-terminal kinase (JNK), p38, and extracellular signal-regulated kinase. These factors have been shown to play critical roles during osteoclast differentiation (Park, Lee, & Lee, 2017). OPG usually acts as an inhibitor of osteoclastogenesis due to its competition with RANKL for the binding of RANK. Moreover, it was also reported to promote the separation of osteoclasts adhering to the bone matrix from the bone surface (O’Brien, Williams, & Marshall, 2001). OPG expression was demonstrated to be decreased in PDLCs subjected to compressive force as well as gingival crevicular fluid during OTM (Kim, Park, Park, Lee, & Kang, 2013; Li et al., 2015; Nishijima et al., 2006), while the underlying mechanisms are not reported yet to the best of our knowledge. Our study provided evidence that the Hippo signaling component, TEAD1 decreases in response to compressive force stimuli, which contributes to reduction of OPG and thereby promoting osteoclastogenesis of co-cultured osteoclast precursors. Besides its role in mediating osteoclastogenesis during OTM, aberrant RANKL/OPG could lead to a variety of diseases involving bone metabolism, such as osteoporosis, rheumatoid arthritis, multiple myeloma and periodontitis (Barbato et al., 2015; Phetfong et al., 2016; Walsh & Choi, 2014). Meta-analyses revealed that OPG polymorphisms are associated with bone mineral density and osteoporosis (Sun et al., 2014, Wang et al., 2013); circulating OPG levels are elevated in rheumatoid arthritis (Wang et al., 2017); OPG concentration is also associated with the presence and severity of peripheral arterial disease in type 2 diabetes mellitus (Demkova, Kozarova, Malachovska, Javorsky, & Tkac, 2018). These findings indicate important roles of OPG in maintaining bone homeostasis. As regard to molecular mechanisms regulating OPG expression, estrogen was reported to stimulate OPG expression at transcriptional level through the estrogen receptor (ER), and at post-transcriptional level via miRNA (Hofbauer et al., 1999; Jia, Zhou, Zeng, & Feng, 2017). Other transcription factors of OPG include homeobox family members (Hox) (Wan, Shi, Feng, & Cao, 2001), smad (Thirunavukkarasu et al., 2001), transcription factor 4 (TCF-4) (De Toni et al., 2008) and GATA binding protein 3 (GATA3) as previously reported (Kao & Stankovic, 2015). Our study demonstrated that TEAD1 positively regulates OPG expression, through binding on a potential enhancer element ˜22 kilobases away from OPG promoter, and this occupancy declines with force application. Therefore, we identified TEAD1 as a novel regulator of OPG during mechanotransduction. Future work should be carried out as to uncover the precise binding site of TEAD1 on the enhancer element, as well as whether the binding site possesses enhancer activity examined by reporter assay. Given the critical role of OPG in the occurrence of bone metabolism-related diseases, it is plausible to speculate that TEAD1-mediated OPG regulation might also be involved in pathogenesis of these diseases. Hippo cascade has been identified as a mechanotransduction signaling pathway responsive to different kinds of physical cues, including cell matrix stiffness, cell geometry, cell density, cell adhesion and the external mechanical stimuli (Meng et al., 2016). Mechanical signals, in most scenarios, modulate phosphorylation events of the core kinase cascade with YAP/TAZ phosphorylation finally affected, which further influences the nuclear localization of YAP/TAZ and the recruitment of TEADs transcription factors (Meng et al., 2016; Schroeder & Halder, 2012). It is previously reported that static equiaxial strain could induce dynamic nuclear YAP localization in human PDLCs (Huelter-Hassler, Tomakidi, Steinberg, & Jung, 2017). However, transcriptional changes of Hippo components in response to compressive force and their impact on osteoclastogenesis are still not clear. Our study for the first time identified TEAD1 as a compressive force responsive gene in human PDLCs, which decreases upon force application and correlates with the expression of OPG. OPG expression was also affected by pharmaceutical interference of Hippo components, suggesting that Hippo signaling might be implicated in osteoclastogenesis during OTM. Future work should be performed to unravel the upstream molecular mechanisms causing the transcriptional decline of TEAD1, which are likely to be orchestrated by epigenetic changes upon force application. In summary, our results highlighted an intriguing mechanism by which OPG is regulated by force-induced decline of TEAD1, thus providing new insights into molecular mechanisms of osteoclastogenesis mediated by PDLCs during OTM. Conflict of interest The Authors declare that they have no conflict of interest related to this study. Contribution of authors Qian Li designed the study, acquired and analyzed the data, drafted the article and gave final approval of the version to be submitted. Gaofeng Han contributed to acquisition of data, revised the paper critically, and gave final approval of the version to be submitted. Dawei Liu contributed to analysis and interpretation of data, revised the paper critically for important intellectual content, and gave final approval of the version to be submitted. Yanheng Zhou contributed to conception of the study, revised the paper critically for important intellectual content, and gave final approval of the version to be submitted. Acknowledgements This work was supported by the National Natural Science Foundation of China (81502345 to Qian Li, and 81470717 to Yanheng Zhou). The authors report no conflicts of interest related to this study. References Baloul, S. S. (2016). Osteoclastogenesis and osteogenesis during tooth movement. Frontiers of Oral Biology, 18, 75–79. Barbato, L., Francioni, E., Bianchi, M., Mascitelli, E., Marco, L. B., & Tonelli, D. P. (2015). Periodontitis and bone metabolism. Clinical Cases in Mineral and Bone Metabolism, 12(2), 174–177. Beertsen, W., McCulloch, C. A., & Sodek, J. (1997). The periodontal ligament: A unique, multifunctional connective tissue. Periodontology, 2000(13), 20–40. Boyle, W. J., Simonet, W. S., & Lacey, D. L. (2003). Osteoclast differentiation and activation. Nature, 423(6937), 337–342. Consortium, E. P. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature, 489(7414), 57–74. De Toni, E. N., Thieme, S. E., Herbst, A., Behrens, A., Stieber, P., Jung, A., ... Kolligs, F. T. (2008). OPG is regulated by beta-catenin and mediates resistance to TRAIL-induced apoptosis in colon cancer. Clinical Cancer Research, 14(15), 4713–4718. Demkova, K., Kozarova, M., Malachovska, Z., Javorsky, M., & Tkac, I. (2018). Osteoprotegerin concentration is associated with the presence and severity of peripheral arterial disease in type 2 diabetes mellitus. Vasa, 47(2), 131–135. Fan, F., He, Z., Kong, L. L., Chen, Q., Yuan, Q., Zhang, S., ... Zhou, D. (2016). Pharmacological targeting of kinases MST1 and MST2 augments tissue repair and regeneration. Science Translational Medicine, 8(352), 352ra108. Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 31

Archives of Oral Biology 100(2019)23-32 Heinz, S, Benner, C, Spann, N, Bertolino, E, Lin, Y. C, Laslo, P,.Glass, C. K.(2010). O'Brien, E. A. williams, J. H, Marshall, M. J.(2001). simple combinations of lineage-determining transcription factors prime cis-r when prostaglandin synthesis is inhibited causing ost testas te gering i prod th ulatory elements required for macrophage and B cell identities. Molecular Cell, 38(4), surface of mouse parietal bone and attach to the endocranial membrane. Bone, 28(2), Hofbauer, L C, Khosla, S, Dunstan, C R, Lacey, D L, Spelsberg, T C, Riggs, B L. Panciera, T, Azzolin, L, Cordenons, M,& Piccolo, S(2017). Mechanobiology of YAP 1999). Estrogen stimulates gene expression and protein production of osteoprote- and disease ys Molecular Cell Biology. 18(12), tic cells. En Hong, Park, J H, Lee, N K,& Lee, S Y (2017). Current understanding of RANK signaling n. Molecules and Cells, 40(10),706- Phetfong, J, Sanvoranart, T, Nartprayut, K, Nimsanor, N, Seenprachawong uelter-Hassler, D, Tomakidi, P, Steinberg, T, Jung, B. A.(2017). Orthodontic strain asittikul, V.,.. Supokawej, A.(2016). Osteoporosis: The current status of ffects the Hippo-pathway effector YAP concomitant with prolifer eriodontal ligament fibroblasts. European Journal of Orthodontics, 39(3), 251-257 Pobbati, A V,& Hong. W.(2013). Emerging roles of Ti ascription factors and its Iwata, T, Yamato, M, Zhang, Z, Mukobata, S, Washio, K, Ando, T,. Ishikawa, L. coactivators in cancers. Cancer Biology Therapy, 14(5), 390-398 (2010). Validation of human periodontal ligament-derived cells as a reliable sour Schroeder, M. C,& Halder, G. (2012). Regulation of the Hippo pathway by cell archi Clinical Periodontology, 37(12), 1088-1099 ture and mechanical signals. Seminars in Cell Developmental Biology, 23(7), Jacquemin, P, Sapin, V, Alsat, E, Evain-Brion, D, Dolle, P, Davidson, 1.(1998). Differential expression of the TEF family of transcription factors in the murine pla- Simonet, W.S., Lacey, D L, Dunstan, CR, Kelley, M, Chang, M S, Luthy, R, . Boyle, N. J(1997). Osteoprotegerin: A novel secreted protein involved in the regulation of bone density. Cell, 89(2), 309-319. Jia, J, Zhou, H, Zeng, x,& Feng, S(2017). Estrogen stimulates osteoprotegerin ex Sun, T, Chen, M, Lin, X, Yu, R, Zhao, Y,& Wang, J(2014). The influence of osteo- RCmR4153我4MM Chinese postmen Jiang, N, Guo, W, Chen, M, Zheng, Y, Zhou, J, Kim, S. G., -. Mao, J. J. (2016). Thirunavukkarasu, K, Miles, R. R, Halladay, D L, Yang, X, Galvin, R. J, Chandrasekhar, S.,. Onyia, J E(2001). Stimulation of osteoprotegerin(OPG)gene or-beta Ku如 Cullinan, E. B, Latham, K.E.,Dm出ML9DT四3可m由 TGF-beta effects. The Journo可mhm Kaneko, K J..& Dep M. L(1998). Regulation of gene expression at the be- ginning of mammalian development and the TEAD family of transcription factors. Developmental Genetics, 22(1), 43-55 Uhler, C,& Shivashankar, G. V(2017) Regulation of genome organization and gene Kanzaki, H, Chiba, M. Takahashi, L, Haruyama, N, Nishimura, M, Mitani. H. (2004). expression by nuclear mechanotransduction. Nature Reviews Molecular Cell Biology. Local oPG gene transfer to periodontal tissue inhibits orthodontic to of Dental Research. 83(12), 920-925 Walsh, M. C,& Choi, Y(2014). Biology of the RANKL-RANK-OPG system in immunity, Kao, S.Y., Stankovic, K M.(2015). Transactivation of human osteoprotegerin promoter bone, and beyond. Frontiers in Immunology, 5, 511 by GATA-3. Scientific Reports, 5, 12479 Wan, M, Shi, X, Feng, X,& Cao, X (2001). Transcriptional mechanisms of bone me phogenetic protein-induced osteoprotegerin expression. The Journal of Biological The FASEB Journal 32(5), 2706-2721 Wang, P, Li, S, Liu, L N, Lv, T. T, Li, X. M, Li, X. P,. Pan, H F(2017). Circulating Kim, S.J., Park, K. H, Park, Y G, Lee, S w,& Kang, Y. G(2013). Compressive stres osteoprotegerin levels are elevated in rheumatoid arthritis: A systematic review and induced the up-regulation of M-CSF, RANKL, TNF-alpha expression and the down egulation of OPG expression in PDL cells via the integrin-FAK pathway. Archives of Wang, Q, Chen, Z, Huang, Y, Li, Q, Zhu, L, Cai, X,. Liu, Q.(2013). The relationship Oral Biology, 58(6), etween osteoprotegerin gene polymorphisms and bone mineral density in Chine Li, B, Zhang, Y H, Wang, L X, Li, X,& Zhang, X D(2015). Expression of OPG, RANKL emational Immunopharmacology, 17(2), 404-407. and RUNX2 in rabbit periodontium under orthodontic force. Genetics and Molecular Wei, H, Wang, F, Wang, Y,, Li, T, Xiu, P, Zhong, J,-Li, J(2017). Verteporfin sup- esearch14(4),19382-1 presses cell surv Li, Q, Ma, Y, Zhu, Y, Zhang, T,& Zhou, Y (2017) Declined expression of histone denocarcinoma via disrupting the YAP-TEAD complex. Cancer Science, 108(3), deacetylase 6 contributes to periodontal ligament stem cell aging. Journal of endodontology, 88(1), e12-e23 Xiao, J. H, Davidson, L, Matthes, H, Garnier, J. M, Chambon, P(1991). Cloning Li, Y, Li, M, Tan, L, Huang, S, Zhao, L, Tang, T.,. Zhao, Z.(2013). Analysis of time- ession, and transcriptional properties of the human enhancer factor TEF-1. Cell, course gene expression profiles of a periodontal ligament tissue model under com 65(4),551-568 pression. Archives of Oral Biology, 58 1-522 Yamaguchi, M.(2009). RANK/RANKL/OPG during orthodontic tooth movement. 6mm工图1Amay0m是间m12119 Li, Y, Zheng, w, Liu, J. S, Wang, J, Yang, P, Li, M. L,. Zhao, Z. H. (2011). Ex f osteoclastogenesis inducers in a tissue mod Yu, F. X, Zhao, B,& Guan, K L(2015). Hippo pathway in organ size control, tissue omeostasis, and cancer. Cell, 163(4),811-828. resses the oncogenic activity of YAP. Genes Development, 26(12), YAP to repress transcription. The EMBO Joumal, 23(4),790-799. Mendez, M. G, Janmey, P. A(2012). Transcription factor regulation Zanconato, F, Cordenons, M,& Piccolo, S(2016). YAP/TAZ at the stress. The International Journal of Biochemistry Cell Biology, 44(5), 728-732. Cancer Cell, 29(6), 783-803 Meng, Z, Moroishi, T,& Guan, K L(2016) Mechanisms of Hippo pathway regulation. Zhang, Y, Zhang, D, Li, Q, Liang, J, Sun, L, Yi, X,.Shang, Y (2016). Nucleation of Genes Development, 30(1), 1-1 DNA repair factors by FOXAl links DNA demethylation to transcriptional pioneering. N(2005). Optimal compressive force induces bone formation via increasing bone, Zheng, w. Wang, S, Ma, D, Tang, L Duan, y, Jin, y. 2009). Loss of proliferation and nd prostaglandin E(2) production appropriately. Life Sciences, 77(25) differentiation capacity of aged human periodontal ligament stem cells and re- by exposure to the young extrins Tissue Engineering Part A, Nishijima, Y, Yamaguchi, M, Kojima, T, Aihara, N, Nakajima, R,& Kasai, K(2006). Zhou, Y, Huang, T, Cheng, A.S., Yu, J, Kang, W,& To, K F (2016). The TEAD family of compression force on releases from periodontal ligament cells in vitro. Orthodontics& Craniofacial Research, 9(2), 63-70. ciences, 17(1)
Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y. C., Laslo, P., ... Glass, C. K. (2010). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular Cell, 38(4), 576–589. Hofbauer, L. C., Khosla, S., Dunstan, C. R., Lacey, D. L., Spelsberg, T. C., & Riggs, B. L. (1999). Estrogen stimulates gene expression and protein production of osteoprotegerin in human osteoblastic cells. Endocrinology, 140(9), 4367–4370. Hong, J. H., Hwang, E. S., McManus, M. T., Amsterdam, A., Tian, Y., Kalmukova, R., ... Yaffe, M. B. (2005). TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science, 309(5737), 1074–1078. Huelter-Hassler, D., Tomakidi, P., Steinberg, T., & Jung, B. A. (2017). Orthodontic strain affects the Hippo-pathway effector YAP concomitant with proliferation in human periodontal ligament fibroblasts. European Journal of Orthodontics, 39(3), 251–257. Iwata, T., Yamato, M., Zhang, Z., Mukobata, S., Washio, K., Ando, T., ... Ishikawa, I. (2010). Validation of human periodontal ligament-derived cells as a reliable source for cytotherapeutic use. Journal of Clinical Periodontology, 37(12), 1088–1099. Jacquemin, P., Sapin, V., Alsat, E., Evain-Brion, D., Dolle, P., & Davidson, I. (1998). Differential expression of the TEF family of transcription factors in the murine placenta and during differentiation of primary human trophoblasts in vitro. Developmental Dynamics, 212(3), 423–436. Jia, J., Zhou, H., Zeng, X., & Feng, S. (2017). Estrogen stimulates osteoprotegerin expression via the suppression of miR-145 expression in MG-63 cells. Molecular Medicine Reports, 15(4), 1539–1546. Jiang, N., Guo, W., Chen, M., Zheng, Y., Zhou, J., Kim, S. G., ... Mao, J. J. (2016). Periodontal ligament and alveolar bone in health and adaptation: Tooth movement. Frontiers of Oral Biology, 18, 1–8. Kaneko, K. J., & DePamphilis, M. L. (1998). Regulation of gene expression at the beginning of mammalian development and the TEAD family of transcription factors. Developmental Genetics, 22(1), 43–55. Kaneko, K. J., Cullinan, E. B., Latham, K. E., & DePamphilis, M. L. (1997). Transcription factor mTEAD-2 is selectively expressed at the beginning of zygotic gene expression in the mouse. Development, 124(10), 1963–1973. Kanzaki, H., Chiba, M., Takahashi, I., Haruyama, N., Nishimura, M., & Mitani, H. (2004). Local OPG gene transfer to periodontal tissue inhibits orthodontic tooth movement. Journal of Dental Research, 83(12), 920–925. Kao, S. Y., & Stankovic, K. M. (2015). Transactivation of human osteoprotegerin promoter by GATA-3. Scientific Reports, 5, 12479. Kegelman, C. D., Mason, D. E., Dawahare, J. H., Horan, D. J., Vigil, G. D., Howard, S. S., ... Boerckel, J. D. (2018). Skeletal cell YAP and TAZ combinatorially promote bone development. The FASEB Journal, 32(5), 2706–2721. Kim, S. J., Park, K. H., Park, Y. G., Lee, S. W., & Kang, Y. G. (2013). Compressive stress induced the up-regulation of M-CSF, RANKL, TNF-alpha expression and the downregulation of OPG expression in PDL cells via the integrin-FAK pathway. Archives of Oral Biology, 58(6), 707–716. Li, B., Zhang, Y. H., Wang, L. X., Li, X., & Zhang, X. D. (2015). Expression of OPG, RANKL, and RUNX2 in rabbit periodontium under orthodontic force. Genetics and Molecular Research, 14(4), 19382–19388. Li, Q., Ma, Y., Zhu, Y., Zhang, T., & Zhou, Y. (2017). Declined expression of histone deacetylase 6 contributes to periodontal ligament stem cell aging. Journal of Periodontology, 88(1), e12–e23. Li, Y., Li, M., Tan, L., Huang, S., Zhao, L., Tang, T., ... Zhao, Z. (2013). Analysis of timecourse gene expression profiles of a periodontal ligament tissue model under compression. Archives of Oral Biology, 58(5), 511–522. Li, Y., Zheng, W., Liu, J. S., Wang, J., Yang, P., Li, M. L., ... Zhao, Z. H. (2011). Expression of osteoclastogenesis inducers in a tissue model of periodontal ligament under compression. Journal of Dental Research, 90(1), 115–120. Liu-Chittenden, Y., Huang, B., Shim, J. S., Chen, Q., Lee, S. J., Anders, R. A., ... Pan, D. (2012). Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes & Development, 26(12), 1300–1305. Mendez, M. G., & Janmey, P. A. (2012). Transcription factor regulation by mechanical stress. The International Journal of Biochemistry & Cell Biology, 44(5), 728–732. Meng, Z., Moroishi, T., & Guan, K. L. (2016). Mechanisms of Hippo pathway regulation. Genes & Development, 30(1), 1–17. Mitsui, N., Suzuki, N., Maeno, M., Mayahara, K., Yanagisawa, M., Otsuka, K., ... Shimizu, N. (2005). Optimal compressive force induces bone formation via increasing bone sialoprotein and prostaglandin E(2) production appropriately. Life Sciences, 77(25), 3168–3182. Nishijima, Y., Yamaguchi, M., Kojima, T., Aihara, N., Nakajima, R., & Kasai, K. (2006). Levels of RANKL and OPG in gingival crevicular fluid during orthodontic tooth movement and effect of compression force on releases from periodontal ligament cells in vitro. Orthodontics & Craniofacial Research, 9(2), 63–70. O’Brien, E. A., Williams, J. H., & Marshall, M. J. (2001). Osteoprotegerin is produced when prostaglandin synthesis is inhibited causing osteoclasts to detach from the surface of mouse parietal bone and attach to the endocranial membrane. Bone, 28(2), 208–214. Panciera, T., Azzolin, L., Cordenonsi, M., & Piccolo, S. (2017). Mechanobiology of YAP and TAZ in physiology and disease. Nature Reviews Molecular Cell Biology, 18(12), 758–770. Park, J. H., Lee, N. K., & Lee, S. Y. (2017). Current understanding of RANK signaling in osteoclast differentiation and maturation. Molecules and Cells, 40(10), 706–713. Phetfong, J., Sanvoranart, T., Nartprayut, K., Nimsanor, N., Seenprachawong, K., Prachayasittikul, V., ... Supokawej, A. (2016). Osteoporosis: The current status of mesenchymal stem cell-based therapy. Cellular & Molecular Biology Letters, 21, 12. Pobbati, A. V., & Hong, W. (2013). Emerging roles of TEAD transcription factors and its coactivators in cancers. Cancer Biology & Therapy, 14(5), 390–398. Schroeder, M. C., & Halder, G. (2012). Regulation of the Hippo pathway by cell architecture and mechanical signals. Seminars in Cell & Developmental Biology, 23(7), 803–811. Simonet, W. S., Lacey, D. L., Dunstan, C. R., Kelley, M., Chang, M. S., Luthy, R., ... Boyle, W. J. (1997). Osteoprotegerin: A novel secreted protein involved in the regulation of bone density. Cell, 89(2), 309–319. Sun, T., Chen, M., Lin, X., Yu, R., Zhao, Y., & Wang, J. (2014). The influence of osteoprotegerin genetic polymorphisms on bone mineral density and osteoporosis in Chinese postmenopausal women. International Immunopharmacology, 22(1), 200–203. Thirunavukkarasu, K., Miles, R. R., Halladay, D. L., Yang, X., Galvin, R. J., Chandrasekhar, S., ... Onyia, J. E. (2001). Stimulation of osteoprotegerin (OPG) gene expression by transforming growth factor-beta (TGF-beta). Mapping of the OPG promoter region that mediates TGF-beta effects. The Journal of Biological Chemistry, 276(39), 36241–36250. Toygar, H. U., Kircelli, B. H., Bulut, S., Sezgin, N., & Tasdelen, B. (2008). Osteoprotegerin in gingival crevicular fluid under long-term continuous orthodontic force application. The Angle Orthodontist, 78(6), 988–993. Uhler, C., & Shivashankar, G. V. (2017). Regulation of genome organization and gene expression by nuclear mechanotransduction. Nature Reviews Molecular Cell Biology, 18(12), 717–727. Walsh, M. C., & Choi, Y. (2014). Biology of the RANKL-RANK-OPG system in immunity, bone, and beyond. Frontiers in Immunology, 5, 511. Wan, M., Shi, X., Feng, X., & Cao, X. (2001). Transcriptional mechanisms of bone morphogenetic protein-induced osteoprotegrin gene expression. The Journal of Biological Chemistry, 276(13), 10119–10125. Wang, P., Li, S., Liu, L. N., Lv, T. T., Li, X. M., Li, X. P., ... Pan, H. F. (2017). Circulating osteoprotegerin levels are elevated in rheumatoid arthritis: A systematic review and meta-analysis. Clinical Rheumatology, 36(10), 2193–2200. Wang, Q., Chen, Z., Huang, Y., Li, Q., Zhu, L., Cai, X., ... Liu, Q. (2013). The relationship between osteoprotegerin gene polymorphisms and bone mineral density in Chinese postmenopausal women. International Immunopharmacology, 17(2), 404–407. Wei, H., Wang, F., Wang, Y., Li, T., Xiu, P., Zhong, J., ... Li, J. (2017). Verteporfin suppresses cell survival, angiogenesis and vasculogenic mimicry of pancreatic ductal adenocarcinoma via disrupting the YAP-TEAD complex. Cancer Science, 108(3), 478–487. Xiao, J. H., Davidson, I., Matthes, H., Garnier, J. M., & Chambon, P. (1991). Cloning, expression, and transcriptional properties of the human enhancer factor TEF-1. Cell, 65(4), 551–568. Yamaguchi, M. (2009). RANK/RANKL/OPG during orthodontic tooth movement. Orthodontics & Craniofacial Research, 12(2), 113–119. Yu, F. X., Zhao, B., & Guan, K. L. (2015). Hippo pathway in organ size control, tissue homeostasis, and cancer. Cell, 163(4), 811–828. Zaidi, S. K., Sullivan, A. J., Medina, R., Ito, Y., van Wijnen, A. J., Stein, J. L., ... Stein, G. S. (2004). Tyrosine phosphorylation controls Runx2-mediated subnuclear targeting of YAP to repress transcription. The EMBO Journal, 23(4), 790–799. Zanconato, F., Cordenonsi, M., & Piccolo, S. (2016). YAP/TAZ at the roots of cancer. Cancer Cell, 29(6), 783–803. Zhang, Y., Zhang, D., Li, Q., Liang, J., Sun, L., Yi, X., ... Shang, Y. (2016). Nucleation of DNA repair factors by FOXA1 links DNA demethylation to transcriptional pioneering. Nature Genetics, 48(9), 1003–1013. Zheng, W., Wang, S., Ma, D., Tang, L., Duan, Y., & Jin, Y. (2009). Loss of proliferation and differentiation capacity of aged human periodontal ligament stem cells and rejuvenation by exposure to the young extrinsic environment. Tissue Engineering Part A, 15(9), 2363–2371. Zhou, Y., Huang, T., Cheng, A. S., Yu, J., Kang, W., & To, K. F. (2016). The TEAD family and its oncogenic role in promoting tumorigenesis. International Journal of Molecular Sciences, 17(1). Q. Li, et al. Archives of Oral Biology 100 (2019) 23–32 32