P1 ant Cell Rep(2006)25:1052-1058 D0I10.1007/s00299-006-0161-2 GENETIC TRANSFORMATION AND HYBRIDIZATION A.Pietrosiuk·K.Syklowska-Baranek· H.Wiedenfeld.R.Wolinowska.M.Furmanowa. E.Jaroszyk The shikonin derivatives and pyrrolizidine alkaloids in hairy root cultures of Lithospermum canescens (Michx.)Lehm. Received:15 July 2004/Accepted:23 March 2006/Published online:3 May 2006 C Springer-Verlag 2006 Abstract Hairy root cultures of Lithospermum canescens Introduction were established using three strains of Agrobacterium rhi- zogenes:ATCC 15834,LBA 9402 and NCIB 8196.Eight lines resulting from infection with A.rhizogenes ATCC Lithospermum canescens (Michx.)Lehm.(Boraginaceae) is a common prairie plant also known as Indian paint or 15834 demonstrated sufficient biomass increase and were submitted to further investigations.The contents of acetyl- hoary puccoon.L.canescens grows from Saskatchewan to shikonin (ACS)and isobutyrylshikonin (IBS)in trans- Georgia and West to Texas.Roots of this species contain formed hairy roots made up ca.10%of those observed red dye used by American Indians as face paint(USDA, NRCS.2004). in natural roots of L.canescens (24.35 and 14.48 mg g- DW,respectively).One line,Lc1-D,produced the largest The natural roots of L.canescens yielded the isolation amounts of ACS(2.72 mg g-DW)and IBS(0.307 mg g- of acetylshikonin and isobutyrylshikonin (24.35 and DW).Traces of pyrrolizidine alkaloids(PA),canescine and 14.48 mg g-DW,respectively).Their structures were determined by NMR methods(Pietrosiuk and Wiedenfeld canescenine,were found in all lines of transformed hairy 2005).Earlier,the naphthoquinones isovalerylshikonin roots. and a-methylbutyrylshikonin and the pyrrolizidine alkaloids lycopsamine,7-0-acetyllycopsamine, 7-0- Keywords Agrobacterium rhizogenes.Hairy roots. acetylintermedine as well as four previously unknown Lithospermum canescens.Pyrrolizidine alkaloids. compounds canescine,canescenine,acetylcanescine, Shikonin derivatives and acetylcanescenine,were isolated from L.canescens Abbreviations ACS:acetylshikonin.DW:dry weight plants growing in their natural habitat (Wiedenfeld et al. IBS:isobutyrylshikonin.PA:pyrrolizidine alkaloids 1998,2003).The biological studies of the shikonin derivatives acetylshikonin and isobutyrylshikonin.and the pyrrolizidine alkaloids isolated from L.canescens plants were performed.Pietrosiuk et al.(2004a)were the first to demonstrate the immunomodulatory effect Communicated by M.E.Horn of acetylshikonin and isobutyrylshikonin on the cellular A.Pietrosiuk(☒)，K.Syklowska-Baranek·M.Furmanowa and humoral immunity in Balb/c mice and on F hybrids E.Jaroszyk (Balb/c x C3H).It was also demonstrated that acetyl- Department of Biology and Pharmaceutical Botany, shikonin inhibited cutaneous angiogenesis induced by L-1 Medical University of Warsaw. ul.Banacha 1, sarcoma cells in Balb/c mice (Pietrosiuk et al.2004b).The 02-097 Warsaw,Poland L.canescens root extract was found to possess antibacterial e-mail:ap@farm.amwaw.edu.pl and antifungal activities,also ACS and IBS themselves Tel./Fax:+48-22-57-20-984 isolated from this extract showed potent antibiotic activity H.Wiedenfeld (Pietrosiuk et al.2003b).Moreover,pyrrolizidine alkaloid Pharmazeutisches Institut der Universitat. fraction had a significant impact on the biological param- An der Immenburg 4, eters of the two-spotted spider mite and Colorado potato D-53121 Bonn.Germany beetle.Mites treated with PA showed a high mortality of juveniles,a decrease in female fecundity and a shortened R.Wolinowska Department of Microbiology,Medical University of Warsaw, longevity,whereas Colorado potato beetle larvae had ul.Oczki 3. reduced ability to digest and excrete food (Pietrosiuk et al. 02-007 Warsaw.Poland 2003a;Kropczyniska et al.2004)
Plant Cell Rep (2006) 25: 1052–1058 DOI 10.1007/s00299-006-0161-2 GENETIC TRANSFORMATION AND HYBRIDIZATION A. Pietrosiuk · K. Sykłowska-Baranek · H. Wiedenfeld · R. Wolinowska · M. Furmanowa · E. Jaroszyk The shikonin derivatives and pyrrolizidine alkaloids in hairy root cultures of Lithospermum canescens (Michx.) Lehm. Received: 15 July 2004 / Accepted: 23 March 2006 / Published online: 3 May 2006 C Springer-Verlag 2006 Abstract Hairy root cultures of Lithospermum canescens were established using three strains of Agrobacterium rhizogenes: ATCC 15834, LBA 9402 and NCIB 8196. Eight lines resulting from infection with A. rhizogenes ATCC 15834 demonstrated sufficient biomass increase and were submitted to further investigations. The contents of acetylshikonin (ACS) and isobutyrylshikonin (IBS) in transformed hairy roots made up ca. 10% of those observed in natural roots of L. canescens (24.35 and 14.48 mg g−1 DW, respectively). One line, Lc1-D, produced the largest amounts of ACS (2.72 mg g−1 DW) and IBS (0.307 mg g−1 DW). Traces of pyrrolizidine alkaloids (PA), canescine and canescenine, were found in all lines of transformed hairy roots. Keywords Agrobacterium rhizogenes . Hairy roots . Lithospermum canescens . Pyrrolizidine alkaloids . Shikonin derivatives Abbreviations ACS: acetylshikonin . DW: dry weight . IBS: isobutyrylshikonin . PA: pyrrolizidine alkaloids Communicated by M. E. Horn A. Pietrosiuk () · K. Sykłowska-Baranek · M. Furmanowa · E. Jaroszyk Department of Biology and Pharmaceutical Botany, Medical University of Warsaw, ul. Banacha 1, 02-097 Warsaw, Poland e-mail: ap@farm.amwaw.edu.pl Tel./Fax: +48-22-57-20-984 H. Wiedenfeld Pharmazeutisches Institut der Universitat, ¨ An der Immenburg 4, D-53121 Bonn, Germany R. Wolinowska Department of Microbiology, Medical University of Warsaw, ul. Oczki 3, 02-007 Warsaw, Poland Introduction Lithospermum canescens (Michx.) Lehm. (Boraginaceae) is a common prairie plant also known as Indian paint or hoary puccoon. L. canescens grows from Saskatchewan to Georgia and West to Texas. Roots of this species contain red dye used by American Indians as face paint (USDA, NRCS, 2004). The natural roots of L. canescens yielded the isolation of acetylshikonin and isobutyrylshikonin (24.35 and 14.48 mg g−1 DW, respectively). Their structures were determined by NMR methods (Pietrosiuk and Wiedenfeld 2005). Earlier, the naphthoquinones isovalerylshikonin and α-methylbutyrylshikonin and the pyrrolizidine alkaloids lycopsamine, 7-O-acetyllycopsamine, 7-Oacetylintermedine as well as four previously unknown compounds canescine, canescenine, acetylcanescine, and acetylcanescenine, were isolated from L. canescens plants growing in their natural habitat (Wiedenfeld et al. 1998, 2003). The biological studies of the shikonin derivatives acetylshikonin and isobutyrylshikonin, and the pyrrolizidine alkaloids isolated from L. canescens plants were performed. Pietrosiuk et al. (2004a) were the first to demonstrate the immunomodulatory effect of acetylshikonin and isobutyrylshikonin on the cellular and humoral immunity in Balb/c mice and on F1 hybrids (Balb/c × C3H). It was also demonstrated that acetylshikonin inhibited cutaneous angiogenesis induced by L-1 sarcoma cells in Balb/c mice (Pietrosiuk et al. 2004b). The L. canescensroot extract was found to possess antibacterial and antifungal activities, also ACS and IBS themselves isolated from this extract showed potent antibiotic activity (Pietrosiuk et al. 2003b). Moreover, pyrrolizidine alkaloid fraction had a significant impact on the biological parameters of the two-spotted spider mite and Colorado potato beetle. Mites treated with PA showed a high mortality of juveniles, a decrease in female fecundity and a shortened longevity, whereas Colorado potato beetle larvae had reduced ability to digest and excrete food (Pietrosiuk et al. 2003a; Kropczynska et al. ´ 2004)
1053 To the best of our knowledge,there are no data available fied with 8 g 1-Phytagar(GIBCO).The incubation was concerning the hairy root cultures of L.canescens and their performed at 25C and under 40 umol/m2 s-!fluorescent secondary metabolites,especially shikonin derivatives and lights for 18 h per day.The roots emerging from the in- pyrrolizidine alkaloids.Recently,an effective method of fected sites were transferred to the liquid hormone-free clonal multiplication of L.canescens has been elaborated LS medium supplemented with 0.05%Claforan(Roussel, (Syklowska-Baranek et al.2004). France)after autoclaving and cultured individually at 25C Of the fifty Lithospermum species,Lithospermum ery- in the dark on a gyratory shaker(New Brunswick Scien- throrhizon growing in Asia has been the most thoroughly tific)at 120 rpm.The established hairy root cultures were studied.Transformed roots of L.erythrorhizon have been maintained on hormone-free LS medium supplemented investigated as a promising source of shikonin (Shimo- with 0.25 mg I-1 GA3,starting from the 12th passage also mura et al.1991;Chang and Sim 1996;Yazaki et al.1998). on hormone-free media LS,SH(Schenk and Hildebrandt Shikonin was the first plant secondary metabolite produced 1972)and SH with addition of 0.25 mg 1-1 GA3.All the on industrial scale from plant cell cultures of this species media were solidified with 8 g 1-1 Phytagar. (Fujita et al.1981;Tabata 1985).Most research to date has In further investigations,the eight lines of clone Lcl se- focused on increasing the production of this compound be- lected from 81 lines were also cultivated in liquid hormone- cause of its value as a pharmaceutical agent but shikonin free LS medium.The cultures were carried out in the dark at derivatives could be also of interest from a biological point 25C with subculturing every 6 weeks.To estimate growth, of view.For instance,acetylshikonin is bioactive and shows about 0.3 g fresh weight of 6-week-old hairy roots was lower toxicity than shikonin (Papageorgiou et al.1999). placed on 30 ml of solid medium in 100 ml Erlenmeyer The acetylshikonin and B-hydroxyisovalerylshikonin iso- flasks.Biomass increase was evaluated on the basis of fresh lated from hairy roots of L.erythrorhizon proved to be the weight after 6 weeks of culture as a ratio of harvest weight most biologically active compounds against soil-borne bac- to initial inoculum weight.To determine the accumulation teria and fungi.However,quantitative analysis of shikonin of secondary metabolites,hairy roots from two flasks of derivatives of these roots was not performed(Birgham et al. each root line were harvested after 6 weeks of culture. 1999). Statistical analysis was performed using the StatSoft A method for obtaining transgenic roots of some STATISTICA software. Lithospermum species and recovering naphthoquinone secreted from the medium has been patented(Hiroshi and Hitoshi 1988). Confirmation of the transformed nature of the roots The objective of this study was to obtain hairy root cultures of L.canescens as a new alternative source of PCR reaction was performed for T-DNA detection in roots shikonin derivatives.The growth of hairy root cultures and of the analyzed plants.Total DNA was isolated from pow- acetylshikonin and isobutyrylshikonin contents were in- dered roots frozen in liquid nitrogen and extraction of vestigated.The selection of a transformed root line of L. chromosomal DNA using DNAzol Reagent(GIBCO-BRL) canescens should allow the production of higher amounts of with purification on silica particles(Boom et al.1999).For shikonin derivatives through large-scale cultures in biore- some samples,especially those containing shoots,addi- actors. tional phenol/chloroform extraction and precipitation were performed.The following oligomer primers were used as a primers:CTGTACCTCTACGTCGACT,TCAGTC- Materials and methods GAGTGGGCTCCTTG,according to the programme:ini- tial denaturisation at 94C for 1.5 min;30 cycles at 94C for Transformed hairy root culture 20 s.60C for 40 s.and then 72C for 1.5 min (Hosokawa et al.1997).For all samples,except control plants,the Transformed hairy root cultures of L.canescens were es- predicted product(1.1 kb)was obtained (data not shown). tablished using three strains of Agrobacterium rhizogenes: ATCC 15834.LBA 9402 and NCIB 8196.The bacteria were grown on YEB solid medium (Vervliet et al.1975) Analytical methods 24 h at 24C,in the dark.Next,single colonies were inoc- ulated into 50 ml YEB liquid medium and cultured 72 h Shikonin derivatives and pyrrolizidine alkaloids(PA)were at 24C in the dark,on a gyratory shaker(New Brunswick extracted from samples of eight lines of L.canescens Scientific)at 120 rpm.The bacterial cultures were diluted transformed roots.For obtaining dye fractions.the (1:4)with YEB liquid medium before transformation.The powdered sample (0.28-1.00 g)of lyophilized trans- leaves and stems of ten 6-week-old shoots of plantlet clones formed roots was sonicated with n-hexane (6 x 50 ml) (Lc1,Lc2,Lc7,Lc8 and Lc9)obtained from seedlings for 30 min at 40C.The extracts were filtered through of L.canescens micropropagated separately (Syklowska- Whatman No.2 paper and the solvent was evaporated Baranek et al.2004)were directly wounded with ster- from the extract solution under reduced pressure.Dry ile needles containing bacteria.The infected shoots were residue was dissolved in methanol and investigated in a placed on hormone-free LS medium (Linsmaier and Skoog DIONEX HPLC system,equipped with an automated 1965)with the addition of sucrose (30 g 1-)and solidi- sample injector (ASI-100),and UVD 340S detector using
1053 To the best of our knowledge, there are no data available concerning the hairy root cultures of L. canescens and their secondary metabolites, especially shikonin derivatives and pyrrolizidine alkaloids. Recently, an effective method of clonal multiplication of L. canescens has been elaborated (Sykłowska-Baranek et al. 2004). Of the fifty Lithospermum species, Lithospermum erythrorhizon growing in Asia has been the most thoroughly studied. Transformed roots of L. erythrorhizon have been investigated as a promising source of shikonin (Shimomura et al. 1991; Chang and Sim 1996; Yazaki et al. 1998). Shikonin was the first plant secondary metabolite produced on industrial scale from plant cell cultures of this species (Fujita et al. 1981; Tabata 1985). Most research to date has focused on increasing the production of this compound because of its value as a pharmaceutical agent but shikonin derivatives could be also of interest from a biological point of view. For instance, acetylshikonin is bioactive and shows lower toxicity than shikonin (Papageorgiou et al. 1999). The acetylshikonin and β-hydroxyisovalerylshikonin isolated from hairy roots of L. erythrorhizon proved to be the most biologically active compounds against soil-borne bacteria and fungi. However, quantitative analysis of shikonin derivatives of these roots was not performed (Birgham et al. 1999). A method for obtaining transgenic roots of some Lithospermum species and recovering naphthoquinone secreted from the medium has been patented (Hiroshi and Hitoshi 1988). The objective of this study was to obtain hairy root cultures of L. canescens as a new alternative source of shikonin derivatives. The growth of hairy root cultures and acetylshikonin and isobutyrylshikonin contents were investigated. The selection of a transformed root line of L. canescensshould allow the production of higher amounts of shikonin derivatives through large-scale cultures in bioreactors. Materials and methods Transformed hairy root culture Transformed hairy root cultures of L. canescens were established using three strains of Agrobacterium rhizogenes: ATCC 15834, LBA 9402 and NCIB 8196. The bacteria were grown on YEB solid medium (Vervliet et al. 1975) 24 h at 24◦C, in the dark. Next, single colonies were inoculated into 50 ml YEB liquid medium and cultured 72 h at 24◦C in the dark, on a gyratory shaker (New Brunswick Scientific) at 120 rpm. The bacterial cultures were diluted (1:4) with YEB liquid medium before transformation. The leaves and stems of ten 6-week-old shoots of plantlet clones (Lc1, Lc2, Lc7, Lc8 and Lc9) obtained from seedlings of L. canescens micropropagated separately (SykłowskaBaranek et al. 2004) were directly wounded with sterile needles containing bacteria. The infected shoots were placed on hormone-free LS medium (Linsmaier and Skoog 1965) with the addition of sucrose (30 g l−1) and solidi- fied with 8 g l−1 Phytagar (GIBCO). The incubation was performed at 25◦C and under 40 µmol/m2 s−1 fluorescent lights for 18 h per day. The roots emerging from the infected sites were transferred to the liquid hormone-free LS medium supplemented with 0.05% Claforan (Roussel, France) after autoclaving and cultured individually at 25◦C in the dark on a gyratory shaker (New Brunswick Scientific) at 120 rpm. The established hairy root cultures were maintained on hormone-free LS medium supplemented with 0.25 mg l−1 GA3, starting from the 12th passage also on hormone-free media LS, SH (Schenk and Hildebrandt 1972) and SH with addition of 0.25 mg l−1 GA3. All the media were solidified with 8 g l−1 Phytagar. In further investigations, the eight lines of clone Lc1 selected from 81 lines were also cultivated in liquid hormonefree LS medium. The cultures were carried out in the dark at 25◦C with subculturing every 6 weeks. To estimate growth, about 0.3 g fresh weight of 6-week-old hairy roots was placed on 30 ml of solid medium in 100 ml Erlenmeyer flasks. Biomass increase was evaluated on the basis of fresh weight after 6 weeks of culture as a ratio of harvest weight to initial inoculum weight. To determine the accumulation of secondary metabolites, hairy roots from two flasks of each root line were harvested after 6 weeks of culture. Statistical analysis was performed using the StatSoftr STATISTICA software. Confirmation of the transformed nature of the roots PCR reaction was performed for T-DNA detection in roots of the analyzed plants. Total DNA was isolated from powdered roots frozen in liquid nitrogen and extraction of chromosomal DNA using DNAzol Reagent (GIBCO-BRL) with purification on silica particles (Boom et al. 1999). For some samples, especially those containing shoots, additional phenol/chloroform extraction and precipitation were performed. The following oligomer primers were used as a primers: CTGTACCTCTACGTCGACT, TCAGTCGAGTGGGCTCCTTG, according to the programme: initial denaturisation at 94◦C for 1.5 min; 30 cycles at 94◦C for 20 s, 60◦C for 40 s, and then 72◦C for 1.5 min (Hosokawa et al. 1997). For all samples, except control plants, the predicted product (1.1 kb) was obtained (data not shown). Analytical methods Shikonin derivatives and pyrrolizidine alkaloids (PA) were extracted from samples of eight lines of L. canescens transformed roots. For obtaining dye fractions, the powdered sample (0.28–1.00 g) of lyophilized transformed roots was sonicated with n-hexane (6 × 50 ml) for 30 min at 40◦C. The extracts were filtered through Whatman No. 2 paper and the solvent was evaporated from the extract solution under reduced pressure. Dry residue was dissolved in methanol and investigated in a DIONEX HPLC system, equipped with an automated sample injector (ASI-100), and UVD 340S detector using
1054 the following conditions:gradient elution-acetonitrile Table 1 Lithospermum canescens hairy roots clone Lcl biomass (40-0 ml)/0.04 M orthophosphoric acid (60-100 ml):flow increase based on fresh weight estimated after 6 weeks of culture rate 1.5 ml min;column:EC 250/4.6 Nucleosil 120- Line of Medium 127 mm Cis (Macherey-Nagel),and monitoring eluent at hairy roots LS LS+GA3 SH SH+GA3 215,278,514,and 320 nm.The extract of natural roots of A 11±3.46a 9±2.31b 12±4.95b 11±4.00b L.canescens collected in June 2001 in Togo,Canada was B 9±3.51a 8±1.53b 11±5.77b 11±4.03b used as a control material.Shikonin (Wako)and its two derivatives acetylshikonin (ACS)and isobutyrylshikonin C 11±7.00a8±3.21b 15±4.11b 9±3.61b D 8±2.56a 6±151a (IBS)isolated previously from natural roots of L.canescens 6±3.51a6±3.05a (Pietrosiuk and Wiedenfeld 2005)were used as the stan- E 13±1.73b10±4.04b12±5.02b 11±2.08b F 16±4.36c 6±1.00a 21±4.15c 19±5.65c dards and analyzed using the same conditions.Peaks were assigned by spiking the samples with the standards and G 8±1.41a 9±1.00b 7±3.21a 7±1.15a comparison of the retention times and UV spectra. H 16±7.73c10±3.25b14±6.61b 12±3.06b To obtain PA fractions,the same samples of transformed Values are means+SE of three experiments with two replicates per roots were sonicated with methanol (4 x 50 ml)for 30 min treatment at 40C.The combined methanolic extracts were evapo- Values within a single column followed by the same letter were not rated under reduced pressure to dryness.The residue was significantly different according to the LSD at the 5%level purified using dichloromethane and ethylic ether,sepa- rately,at pH 2.The total PA fraction was isolated from with strain LBA 9402,respectively.ATCC 15834 was the second most efficient bacterial strain used to transform the extract by shaking two times with dichloromethane after clones Lel,Lc2 and Le7 with 10,3,and 8 roots,respec- adjustment to pH 9 with 25%ammonia and with salting out the water phase after the first stage.TLC,TLC preparative tively.No transformed roots were obtained after treatment (silica gel F254,CH2Cl2-CH3OH-NH4OH 25%,85:14:1). of the plantlet clone Lc9 and only two roots appeared when and then GC-MS analysis,according to Wiedenfeld et al. plantlets of clone Lc8 were infected with strains LBA 9402 and ATCC 15834.A visual estimation of roots obtained af- (2003)were used for the detection of PA in the root extracts ter transformation with LBA 9402 strain revealed that they with the conditions GC-MS:GC:150C(5 min)-250C, 10/min;HP-1,25m×0.32;nj.:250°C,det.:280°C; did not produce shikonin derivatives.Roots were white in comparison to hairy roots obtained after transformation MS:220°C:interface:250°C:2000emV. with ATCC 15834 strain (after the same time of culture). A voucher specimen of L.canescens (Michx.)Lehm. from South of Togo,Saskatchewan,found in sandy soils,is HPLC-UV studies demonstrated only traces of ACS and IBS in these white roots (data not shown).Among all deposited at The W.P.Fraser Herbarium (SASK),Univer- sity of Saskatchewan,Saskatoon,Saskatchewan,Canada, induced roots,eight lines (A-H)developed as a result of infection with A.rhizogenes ATCC 15834 of the plantlet accession number 94815. clone Lc1,demonstrated a sufficient and stable biomass increase (Table 1)and they were submitted to further investigations.These lines of hairy roots were marked Results and discussion with letters from A to H.PCR analyses confirmed their transformation status (data not shown).Roots of eight lines The present study was concerned with the establishment of transformed hairy root cultures of L.canescens and evalu- growing on solid LS medium with GA3 0.25 mg I-1 were ation of their ability to produce shikonin derivatives.The long with good lateral branching(Fig.1).The young roots phytochemical studies were focused on the detection of the (1-2-week-old)were white with red apexes while older dyes acetylshikonin (ACS)and isobutyrylshikonin (IBS) ones (4-6-week-old)became deeply red (Fig.2).These which could be of biological importance as indicated in our earlier studies(Pietrosiuk et al.2003a,b,2004a,b). The variations in the growth and pigment content between different hairy root lines were investigated to evaluate the importance of the clonal selection in shikonin derivative accumulation.The infection of L.canescens stems of 6-week-old plantlets with the A.rhizogenes strains(ATCC 15834,LBA 9402 and NCIB 8196)resulted in hairy root formation.The first root from the infected point emerged 11 days after treatment of the plantlet clone Lc7 with A.rhizogenes LBA 9402.Six weeks later we observed 55 roots after treatment with LBA 9402,and only 22 and three roots when ATCC 15834 or NCIB 8196 were used,respectively.The transformation rate was strongly dependent on the clone and the bacterial strain used.The Fig.1 Hairy roots (1-2-week-old)of Lithospermum canescens highest numbers of developing roots 19,15,and 20 were grown on solid LS medium supplemented with GA3 (line Lc1D). observed after transformation of clones Lc1,Lc2 and Lc7 red apexes are seen (5:1)
1054 the following conditions: gradient elution—acetonitrile (40–0 ml)/0.04 M orthophosphoric acid (60–100 ml); flow rate 1.5 ml min−1; column: EC 250/4.6 Nucleosilr 120– 127 mm C18 (Macherey-Nagel), and monitoring eluent at 215, 278, 514, and 320 nm. The extract of natural roots of L. canescens collected in June 2001 in Togo, Canada was used as a control material. Shikonin (Wako) and its two derivatives acetylshikonin (ACS) and isobutyrylshikonin (IBS) isolated previously from natural roots of L. canescens (Pietrosiuk and Wiedenfeld 2005) were used as the standards and analyzed using the same conditions. Peaks were assigned by spiking the samples with the standards and comparison of the retention times and UV spectra. To obtain PA fractions, the same samples of transformed roots were sonicated with methanol (4 × 50 ml) for 30 min at 40◦C. The combined methanolic extracts were evaporated under reduced pressure to dryness. The residue was purified using dichloromethane and ethylic ether, separately, at pH 2. The total PA fraction was isolated from the extract by shaking two times with dichloromethane after adjustment to pH 9 with 25% ammonia and with salting out the water phase after the first stage. TLC, TLC preparative (silica gel F254, CH2Cl2–CH3OH–NH4OH 25%, 85:14:1), and then GC–MS analysis, according to Wiedenfeld et al. (2003) were used for the detection of PA in the root extracts with the conditions GC–MS: GC: 150◦C (5 min)–250◦C, 10◦/min; HP-1, 25 m × 0.32; Inj.: 250◦C, det.: 280◦C; MS: 220◦C; interface: 250◦C; 2000 emV. A voucher specimen of L. canescens (Michx.) Lehm. from South of Togo, Saskatchewan, found in sandy soils, is deposited at The W.P. Fraser Herbarium (SASK), University of Saskatchewan, Saskatoon, Saskatchewan, Canada, accession number 94815. Results and discussion The present study was concerned with the establishment of transformed hairy root cultures of L. canescens and evaluation of their ability to produce shikonin derivatives. The phytochemical studies were focused on the detection of the dyes acetylshikonin (ACS) and isobutyrylshikonin (IBS), which could be of biological importance as indicated in our earlier studies (Pietrosiuk et al. 2003a, b, 2004a, b). The variations in the growth and pigment content between different hairy root lines were investigated to evaluate the importance of the clonal selection in shikonin derivative accumulation. The infection of L. canescens stems of 6-week-old plantlets with the A. rhizogenes strains (ATCC 15834, LBA 9402 and NCIB 8196) resulted in hairy root formation. The first root from the infected point emerged 11 days after treatment of the plantlet clone Lc7 with A. rhizogenes LBA 9402. Six weeks later we observed 55 roots after treatment with LBA 9402, and only 22 and three roots when ATCC 15834 or NCIB 8196 were used, respectively. The transformation rate was strongly dependent on the clone and the bacterial strain used. The highest numbers of developing roots 19, 15, and 20 were observed after transformation of clones Lc1, Lc2 and Lc7 Table 1 Lithospermum canescens hairy roots clone Lc1 biomass increase based on fresh weight estimated after 6 weeks of culture Line of Medium hairy roots LS LS + GA3 SH SH + GA3 A 11 ± 3.46a 9 ± 2.31b 12 ± 4.95b 11 ± 4.00b B 9 ± 3.51a 8 ± 1.53b 11 ± 5.77b 11 ± 4.03b C 11 ± 7.00a 8 ± 3.21b 15 ± 4.11b 9 ± 3.61b D 8 ± 2.56a 6 ± 3.51a 6 ± 3.05a 6 ± 1.51a E 13 ± 1.73b 10 ± 4.04b 12 ± 5.02b 11 ± 2.08b F 16 ± 4.36c 6 ± 1.00a 21 ± 4.15c 19 ± 5.65c G 8 ± 1.41a 9 ± 1.00b 7 ± 3.21a 7 ± 1.15a H 16 ± 7.73c 10 ± 3.25b 14 ± 6.61b 12 ± 3.06b Values are means ± SE of three experiments with two replicates per treatment Values within a single column followed by the same letter were not significantly different according to the LSD at the 5% level with strain LBA 9402, respectively. ATCC 15834 was the second most efficient bacterial strain used to transform clones Lc1, Lc2 and Lc7 with 10, 3, and 8 roots, respectively. No transformed roots were obtained after treatment of the plantlet clone Lc9 and only two roots appeared when plantlets of clone Lc8 were infected with strains LBA 9402 and ATCC 15834. A visual estimation of roots obtained after transformation with LBA 9402 strain revealed that they did not produce shikonin derivatives. Roots were white in comparison to hairy roots obtained after transformation with ATCC 15834 strain (after the same time of culture). HPLC-UV studies demonstrated only traces of ACS and IBS in these white roots (data not shown). Among all induced roots, eight lines (A–H) developed as a result of infection with A. rhizogenes ATCC 15834 of the plantlet clone Lc1, demonstrated a sufficient and stable biomass increase (Table 1) and they were submitted to further investigations. These lines of hairy roots were marked with letters from A to H. PCR analyses confirmed their transformation status (data not shown). Roots of eight lines growing on solid LS medium with GA3 0.25 mg l−1 were long with good lateral branching (Fig. 1). The young roots (1–2-week-old) were white with red apexes while older ones (4–6-week-old) became deeply red (Fig. 2). These Fig. 1 Hairy roots (1–2-week-old) of Lithospermum canescens grown on solid LS medium supplemented with GA3 (line Lc1D), red apexes are seen (5:1)
1055 1200 mAU 1000 750 625 500 375 1®S-11,305 3 2 250 18-shikon 5.680 9-ACS-987 2 125 Fig.2 Hairy roots (4-6-week-old)of Lithospermum canescens grown in liquid LS medium supplemented with GA3(line LcID) (3:1) observations are in agreement with results obtained by 20 Birgham et al.(1999).The growth of hairy roots decreased 0,0 2,0 4,0 6,0 8,0 10,0 12,0 14,0 16,0 when they were cultivated on the media supplemented with Time (min.) GA3.However.the differences were statistically significant Fig.3 HPLC-UV chromatograms of investigated plant material of only for lines Lc1-C,Lc1-E,Lcl-F and Lc1-H cultivated Lithospermum canescens on media LS in comparison to LS with addition of GA3, 1.HPLC separation of standard'mixture (shikonin R 5.680 min., and the same for lines Lc1-C.Lc1-F and Lc1-H when ACS R,8.387 min..IBS R,11.305 min).=215 nm maintained on SH and SH with GA3 media (Table 1). 2.HPLC separation of Lithospermum canescens natural roots extract Canada2001),入=215nm Eight lines of L.canescens hairy roots were chemically 3.HPLC separation of Lithospermum canescens transformed roots analyzed after they had produced required biomass follow- extract (line Lc1-D).A=215 nm ing 12 passages.During three subsequent passages starting from the 12th one,the investigated hairy root lines were shikonin and its derivatives on soil-borne microorganisms. cultivated on various media to compare their biomass in- However,quantitative analysis of shikonin derivatives of crease and shikonin-type pigment accumulation. these roots was not performed. Shikonin and its derivatives show characteristic UV spec- Until now,no information on the hairy root cultures of trum Amax (MeOH)nm 215,278,and 514.HPLC analysis L.canescens and their secondary metabolites,especially of the pigment fractions from A-H lines of hairy roots of L. shikonin derivatives and pyrrolizidine alkaloids,has been canescens revealed 9-10 compounds (Fig.3).UV spectra reported.However,transformed hairy roots of Asian L.ery- measurements showed the typical UV spectra of shikonin throrhizon have been investigated as a promising source of derivative pigments for seven of them.ACS and IBS were shikonin.Shimomura et al.(1991)obtained hairy roots found in all root lines of L.canescens among other unidenti- cultures of L.erythrorhizon,by transformation of in vitro fied derivatives.These two compounds were the most abun- grown shoots with A.rhizogenes 15834.The authors es- dant in relation to others.The identity of ACS and IBS was tablished an airlift fermenter system for L.erythrorhizon, also confirmed by spiking peaks with standards substances, which continuously produced approximately 5 mg shikonin and comparison of the retention times.The comparison of per day over more than 220 days.The studies of Chang and HPLC chromatograms of two pigment fractions:from con- Sim (1996)showed that shikonin production with in situ trol material (roots of L.canescens collected in June 2001 extraction in L.erythrorhizon transformed cells and hairy in Togo,Canada)and from hairy roots of L.canescens roots by n-hexadecane were 7.6 and 3 times greater than also showed the presence of other unidentified shikonin for a control culture.Yazakiet al.(1998)reported the stable derivatives in hairy roots,which do not occur in roots of in-transformation of L.erythrorhizon using an intron bearing tact plants.Shikonin itself was not detected in either hairy the B-glucuronidase gene as the model gene with the aid of or natural roots of L.canescens.In our investigation,the wide-type A.rhizogenes.In pigment production medium sum of shikonin esters was not expressed as shikonin af- M9,shikonin productivity of the hairy root cultures was ter alkaline hydrolysis as was done in studies of other re-similar to that of cell suspension cultures of Lithospermum searchers (Shimomura et al.1991;Chang and Sim 1996; (Yazaki et al.1998). Yazaki et al.1998).Only Birgham et al.(1999),identified In our studies,the contents of the ACS and IBS in hairy shikonin derivatives:acetylshikonin,isovalerylshikonin,a- roots of L.canescens cultivated on four different media methyl-n-butylshikonin and B-hydroxyisovalerylshikonin were examined.The results of quantitative analyses of from hairy roots of L.erythrorhizon by comparison of the ACS and IBS are summarized in Tables 2 and 3.Among retention time with known standards by HPLC,because one all tested media,the highest yield of ACS and IBS was of the objectives of their study was to analyze the effects of observed when the culture of hairy roots was carried out
1055 Fig. 2 Hairy roots (4–6-week-old) of Lithospermum canescens grown in liquid LS medium supplemented with GA3 (line Lc1D) (3:1) observations are in agreement with results obtained by Birgham et al. (1999). The growth of hairy roots decreased when they were cultivated on the media supplemented with GA3. However, the differences were statistically significant only for lines Lc1-C, Lc1-E, Lc1-F and Lc1-H cultivated on media LS in comparison to LS with addition of GA3, and the same for lines Lc1-C, Lc1-F and Lc1-H when maintained on SH and SH with GA3 media (Table 1). Eight lines of L. canescens hairy roots were chemically analyzed after they had produced required biomass following 12 passages. During three subsequent passages starting from the 12th one, the investigated hairy root lines were cultivated on various media to compare their biomass increase and shikonin-type pigment accumulation. Shikonin and its derivatives show characteristic UV spectrum λmax (MeOH) nm 215, 278, and 514. HPLC analysis of the pigment fractions from A–H lines of hairy roots of L. canescens revealed 9–10 compounds (Fig. 3). UV spectra measurements showed the typical UV spectra of shikonin derivative pigments for seven of them. ACS and IBS were found in all root lines of L. canescens among other unidenti- fied derivatives. These two compounds were the most abundant in relation to others. The identity of ACS and IBS was also confirmed by spiking peaks with standards substances, and comparison of the retention times. The comparison of HPLC chromatograms of two pigment fractions: from control material (roots of L. canescens collected in June 2001 in Togo, Canada) and from hairy roots of L. canescens also showed the presence of other unidentified shikonin derivatives in hairy roots, which do not occur in roots of intact plants. Shikonin itself was not detected in either hairy or natural roots of L. canescens. In our investigation, the sum of shikonin esters was not expressed as shikonin after alkaline hydrolysis as was done in studies of other researchers (Shimomura et al. 1991; Chang and Sim 1996; Yazaki et al. 1998). Only Birgham et al. (1999), identified shikonin derivatives: acetylshikonin, isovalerylshikonin, α- methyl-n-butylshikonin and β-hydroxyisovalerylshikonin from hairy roots of L. erythrorhizon by comparison of the retention time with known standards by HPLC, because one of the objectives of their study was to analyze the effects of Fig. 3 HPLC-UV chromatograms of investigated plant material of Lithospermum canescens 1. HPLC separation of standard mixture (shikonin Rt 5.680 min., ACS Rt 8.387 min., IBS Rt 11.305 min), λ = 215 nm 2. HPLC separation of Lithospermum canescens natural roots extract (Canada 2001), λ = 215 nm 3. HPLC separation of Lithospermum canescens transformed roots extract (line Lc1-D), λ = 215 nm shikonin and its derivatives on soil-borne microorganisms. However, quantitative analysis of shikonin derivatives of these roots was not performed. Until now, no information on the hairy root cultures of L. canescens and their secondary metabolites, especially shikonin derivatives and pyrrolizidine alkaloids, has been reported. However, transformed hairy roots of Asian L. erythrorhizon have been investigated as a promising source of shikonin. Shimomura et al. (1991) obtained hairy roots cultures of L. erythrorhizon, by transformation of in vitro grown shoots with A. rhizogenes 15834. The authors established an airlift fermenter system for L. erythrorhizon, which continuously produced approximately 5 mg shikonin per day over more than 220 days. The studies of Chang and Sim (1996) showed that shikonin production with in situ extraction in L. erythrorhizon transformed cells and hairy roots by n-hexadecane were 7.6 and 3 times greater than for a control culture. Yazaki et al. (1998) reported the stable transformation of L. erythrorhizon using an intron bearing the β-glucuronidase gene as the model gene with the aid of wide-type A. rhizogenes. In pigment production medium M9, shikonin productivity of the hairy root cultures was similar to that of cell suspension cultures of Lithospermum (Yazaki et al. 1998). In our studies, the contents of the ACS and IBS in hairy roots of L. canescens cultivated on four different media were examined. The results of quantitative analyses of ACS and IBS are summarized in Tables 2 and 3. Among all tested media, the highest yield of ACS and IBS was observed when the culture of hairy roots was carried out
1056 ##100#6521.0 95100#000.0 050010865.0 PI600#021L.0 #S200#0111.0 9500车5960 25600-00005.0 #LS00+062.0 6S000斤0660.0 O1500#895c0 8010.0405900 1 EVD+HS 4299.0+755h 09260+880 616.1#z06s 21201f0ss材 2910:0#086t EIL'I F ELSE C.#609 VD+HS (-13)1431Md 22990#105g 6151#206s 2120Tt0859 BILb'I F ELSE 8#260g 0760:0#2860:0 P00.0128090 3620.:0#0698.0 1:010869.0 2e30.0#8169.0 2960.0-0600:0 28100+1Lc2.0 P话00.0H-000.0 P600:0+006.0 2600.0+00500 010.0-000.0 g600.012280.0 1-90.00000.0 e100F6100 (1=13)1431M Kd 9119.5#060:490.0午0060.0 2963.1-#8559 男 29171-#15s p99.0+001k1 RC材0：010005：0 #t2S+Lh6t#材600+0020.1 P9K6-#519.00材0040010.1 hS/#09:26900#70000 580:1-4S0#9:24500限m #650:0+0009.0 (1-13)1431M d 299.10006 4775052590 #290:0#51Sr0 #1100F0LS-r0 7900.0斤00000.0 24材0：010000.5 S5005105.0 19900#05s-0 (uuoxysAB :SOV)suasauDo wmadsounT Jo soo eu u (M-3 3w)sE'SOY Jo uuo a:onuoD o1 3upoooe 'uaj!p Apueoy!uays iou aom n wes a q pamolloj uunjoo aus e urm sanpe 'uouean ad saeoydal omi ym siuawuadxo aom Jo S sueau are sanpeA S1195#00s 23101#Et5s t21#7#6t 2SS0.0-0060.0 PA50:01000:0 #e100FE6h1:0 AA50:040000.0 3K51#509.028910400160 S0.2c00+0.0594L.13+P a0-1-#S真。1500#7961.0 38+93 q9EE'IF090 R775052590 PS8Z'F EZ8'S #929.0#7060 240050000 4600.010080.0 2200:0+06500 20200-80000 F210.0+06900 2:250#089.s #620-F50.c 2055:0#788.h 2600:0#720h #1K-#090s 9I'I00'S 2S59060505 26901--501s 2051017085 凸 8600:0170.h qILE'I080'S 295-T#000c (uuoysnqos!:SgI)suasauo wmuiadsoun7 Jo sioo u (M 3w)8I SgI Jo luoa:JonuoD U 工 工
1056 Table 2 Hairy roots of Lithospermum canescens clone Lc1 dry weight and content of acetylshikonin (mg g−1 DW) estimated after 6 weeks of culture Medium LS LS + GA3 SH SH + GA3 Line of hairy roots Dry weight (g l−1) ACS Dry weight (g l−1) ACS Dry weight (g l−1) ACS Dry weight (g l−1) ACS A 5.650 ± 0.923c 0.1513 ± 0.062a 4.060 ± 1.336b 0.6200 ± 0.062b 5.640 ± 2.611b 0.7482 ± 0.097e 4.957 ± 0.862b 0.1233 ± 0.014a B 5.103 ± 1.069a 0.1870 ± 0.011a 4.547 ± 1.223c 1.4100 ± 0.88e 6.573 ± 1.898c 0.4632 ± 0.064d 6.183 ± 0.923c 0.1760 ± 0.013b C 4.887 ± 0.770a 0.4000 ± 0.078b 5.110 ± 1.355c 0.4700 ± 0.042a 5.723 ± 1.018b 0.8390 ± 0.024f 5.907 ± 1.919c 0.3260 ± 0.087c D 4.327 ± 0.709b 2.7200 ± 0.048c 3.652 ± 0.522b 1.0260 ± 0.094d 4.947 ± 1.523a 0.8480 ± 0.112f 4.550 ± 1.027b 0.7120 ± 0.091d E 5.080 ± 1.371a 0.1554 ± 0.025a 4.677 ± 1.350d 1.0370 ± 0.247d 7.673 ± 1.976d 0.1267 ± 0.067a 4.980 ± 2.578b 0.1110 ± 0.025a F 5.597 ± 2.348c 0.1552 ± 0.036a 5.823 ± 2.285e 0.6667 ± 0.089b 7.183 ± 2.154d 0.3913 ± 0.083c 5.785 ± 1.488c 0.1265 ± 0.046a G 4.295 ± 1.247b – 3.207 ± 0.628a 0.7763 ± 0.164c 5.143 ± 1.106a 0.7720 ± 0.093e 3.573 ± 1.471a 0.3600 ± 0.093c H 5.040 ± 1.146a – 5.580 ± 2.014e 0.3000 ± 0.039a 6.547 ± 1.471c 0.2271 ± 0.073b 6.097 ± 1.327c 0.1290 ± 0.087a Control: the content of ACS 24.35 (mg g−1 DW) in natural roots of Lithospermum canescens (ACS: acetylshikonin) Values are means ± SE of three experiments with two replicates per treatment. Values within a single column followed by the same letter were not significantly different, according to the LSD at the 5% level Table 3 Hairy roots of Lithospermum canescens clone Lc1 dry weight and content of isobutyrylshikonin (mg g−1 DW) estimated after 6 weeks of culture Medium LS LS + GA3 SH SH + GA3 Line of hairy roots Dry weight (g l−1) IBS Dry weight (g l−1) IBS Dry weight (g l−1) IBS Dry weight (g l−1) IBS A 5.650 ± 0.923c 0.0737 ± 0.053c 4.060 ± 1.336b 0.2900 ± 0.033c 5.640 ± 2.611b 0.1200 ± 0.005d 4.957 ± 0.862b Trace B 5.103 ± 1.069b 0.0800 ± 0.009c 4.547 ± 1.223c 0.4067 ± 0.046d 6.573 ± 1.898c 0.1200 ± 0.009d 6.183 ± 0.923c – C 4.887 ± 0.770b 0.0540 ± 0.072b 5.110 ± 1.355c 0.1493 ± 0.013a 5.723 ± 1.018b 0.0500 ± 0.002c 5.907 ± 1.919c 0.0296 ± 0.003a D 4.327 ± 0.709a 0.0773 ± 0.027c 3.652 ± 0.522b 0.3067 ± 0.048c 4.947 ± 1.523a 0.1000 ± 0.011e 4.550 ± 1.027b 0.1333 ± 0.031c E 5.080 ± 1.371b 0.0392 ± 0.012a 4.677 ± 1.350c 0.4107 ± 0.063d 7.673 ± 1.976d 0.0322 ± 0.009b 4.980 ± 2.578b – F 5.597 ± 2.348c – 5.823 ± 2.285d 0.2200 ± 0.033b 7.183 ± 2.154d 0.1250 ± 0.014d 5.785 ± 1.488c Trace G 4.295 ± 1.247a – 3.207 ± 0.628a 0.1967 ± 0.031b 5.143 ± 1.106a 0.2000 ± 0.035f 3.573 ± 1.471a 0.0625 ± 0.016b H 5.040 ± 1.146b – 5.580 ± 2.014d 0.1433 ± 0.023a 6.547 ± 1.471c 0.0179 ± 0.013a 6.097 ± 1.327c – Control: the content of IBS 14.48 (mg g−1 DW) in natural roots of Lithospermum canescens (IBS: isobutyrylshikonin) Values are means ± SE of three experiments with two replicates per treatment. Values within a single column followed by the same letter were not significantly different according to the LSD at the 5% level
1057 on LS with GA3 medium (Tables 2 and 3).However,the References addition of GA3 to SH medium resulted in lower levels of ACS and IBS.In the presence of GA3,the growth Birgham LA,Michaels PJ,Flores HE (1999)Cell-specific produc- rate of all root lines diminished slightly (Table 1),but tion and antimicrobial activity of naphthoquinones in roots of shikonin derivative production was not affected (Tables 2 Lithospermum erythrorhizon.Plant Physiol 119:417-428 and 3).Different results were obtained by Yoshikawa et al. Boom R.Sol C.Beld M.Weel J.Goudsmit J.Wertheim-van Dillen P (1999)Improved silica-guanidiniumthiocyanate DNA isolation (1986)who observed that GA3 strongly inhibited shikonin procedure based on selective binding of bovine alpha-casein to formation in L.erythrorhizon callus culture but had no silica particles.J Clin Microbiol 37:615-619. effect on cell growth.The line Lc1-D appeared the most Chang HN,Sim SJ(1996)Genetic transformation of Lithospermum suitable for ACS and IBS production on all media tested. erythrorhizon for increased production of shikonin.In:Bajaj This root line yielded ACS and IBS levels ranging from YPS (ed)Biotechnology in agriculture and forestry,vol 38. Plant protoplasts and genetic engineering VII.Springer-Verlag. 0.712 to 2.720 mg g-of dry weight and from 0.0402 to Berlin Heldelberg.pp 233-242 0.307 mg g-of dry weight,respectively.The content was Fujita Y,Hara Y,Suga C,Morimoto T(1981)Production of shikonin not accompanied by abundant biomass increase (Table derivatives by cell suspension cultures of Lithospermum 1).which was the lowest among all investigated hairy erythrorhizon.A new medium for the production of shikonin derivatives.Plant Cell Rep 1:61-63 root lines.This result was consistent with those reported Hiroshi K.Hitoshi S (1988)Production of naphthoquinone by Payne et al.(1991)who found that many secondary compound.JP-J63230093 metabolites were produced by cultures.which were either Hosokawa K.Matsuki R.Oikawa Y.Yamamura S (1997)Genetic not growing at all or growing very slowly.The presence of transformation of gentian using wild-type Agrobacterium rhizogenes.Plant Cell Tissue Organ Cult 51:137-140 PA was also examined in our lines.We detected traces of PA Kropczyriska D,Kawka B,Pietrosiuk A,Furmanowa M,Wiedenfeld in hairy roots of L.canescens (data not shown).The most H(2004)The effect of pyrrolizidine alkaloids on the Colorado sensitive methods for detecting PA on TLC using Ehrlich potato beetle (Leptinotarsa decemlineata Say).Acta Biol reagent (4-dimethylaminobenzaldehyde:Mattocks.1967) Cracoviensia Ser Zool 46:83-86 showed the presence of PA in each examined line of L Linsmaier EM,Skoog F(1965)Organic growth factor requirement in relationship to cytokinin in"normal"and "mutant"strains of canescens hairy roots.This result was confirmed by gas tobacco callus.Planta 72:146-154 chromatography combined with mass spectrometry (GC- Mattocks AR (1967)Detection of pyrrolizidine alkaloids on MS).a valuable and highly sensitive means for the detection thin-layer chromatograms.J Chromatogr 27:505-508 and identification of pyrrolizidine alkaloids.The GC-MS Papageorgiou VP.,Assimopoulou AN.Couladouros EA.Hepworth D,Nicolaou KC,(1999)The chemistry and biology of alkannin, spectrum of investigated compounds shows the [M]-peak shikonin,and related naphtazarin natural products.Angew at 399 indicating the molecular formula C2oH33NO7.The Chem Int Ed 38:270-300 further fragmentations are the same for 7-0-(3-hydroxy- Payne GF,Bringi V,Prince C,Shuler ML(1991)Quantifying growth 3-methyl-butanoyl)-9-0-(+)-trachelanthoyl-heliotridine and product synthesis:kinetics and stoichiometry.In:Payne GF.Bringi V.Prince C.Shuler ML (eds)Plant cell and tissue (canescine)and 7-0-(3-hydroxy-3-methyl-butanoyl)-9-0- culture in liquid systems.Hanser Publishers.Munich Vienna (-)-viridifloryl-heliotridine (canescenine),as described New York Barcelona,pp 48-70 earlier (Wiedenfeld et al.2003). Pietrosiuk A,Furmanowa M,Kropczynska D.Kawka B,Wieden- To summarize briefly,we can state that L.canescens is feld H (2003a)Life history of the two-spotted spider mite susceptible to genetic transformation with A.rhizogenes. (Tetranychus urticae Koch)feeding on bean leaves treated with pyrrolizidine alkaloids.J Appl Toxicol 23:187-190 ACS and IBS are the main compounds among the other Pietrosiuk A.Kedzia B,Holderna-Kedzia E.Wiedenfeld H. unidentified shikonin derivatives in transformed hairy roots Malinowski M,Furmanowa M(2003b)Antimicrobial activity of L.canescens.ACS and IBS contents in hairy roots con- of naphthoquinones from Lithospermum canescens Lehm. stitute ca.10%of those observed in natural roots of L. Herba Polonica 49(3/4):209-215 Pietrosiuk A.Skopiniska-Rozewska E.Furmanowa M.Wiedenfeld canescens(24.35 and 14.48 mg g-DW,respectively).The H,Sommer E,Sokolnicka I,Bany J,Malinowski M(2004a) HPLC-UV results show that shikonin itself could not be Immunomodulatory effect of shikonin derivatives isolated from detected in the transformed hairy roots but more shikonin Lithospermum canescens on cellular and humoral immunity in derivatives were found in transformed hairy roots of L. Balb/c mice.Die Pharmazie 59:640-642 Pietrosiuk A,Furmanowa M,Skopiniska-Rozewska E.Sommer E. canescens than in control roots of plants growing in their Skurzak H,Bany J(2004b)The effect of acetylshikonin isolated natural habitat (Fig.3).Line Lc1-D proved to be a good from Lithospermum canescens roots on tumor-induced cuta- source of shikonin derivatives and will be used to scale up neous angiogenesis.Acta Polon Pharm Drug Res 61(5):379- ACS and IBS production. 382 Pietrosiuk A.Wiedenfeld H(2005)Shikonin derivatives from Lithos- Acknowledgements This investigation was supported by a research permum canescens (Michx.)Lehm.Pharm Biol 43(2):189-191 grant PBZ-KBN-092/P05/2003 from the State 'Committee of Sci- Schenk RU.Hildebrandt AC (1972)Medium and techniques for entific Research.We are thankful to Dr.Branka Barl,chief scien- induction and growth of monocotyledonous and dicotyledonous plant cell cultures.Can J Bot 50:199-204 tist.New Era Nutrition.Inc..Edmonton.Alberta.for plants and Shimomura K.Sudo H.Saga H.Kamada H (1991)Shikonin seeds of L.canescens.We are also grateful to Professor Mondher Jaziri from the Laboratory of Biotechnology and Plant Morphol- production and secretion by hairy root cultures Lithospermum ogy,Free University of Brussels for the bacterial strain A.rhizo- erythrorhizon.Plant Cell Rep 10:282-285 Syklowska-Baranek K,Pietrosiuk A,Dluska H,Furmanowa M genes NCIB 8196.We thank Mr Ireneusz Rudnicki,Photodepart- (2004)Clonal multiplication of Lithospermum canescens ment of Medical University of Warsaw,Poland for photographic (Michx.)Lehm.and Onosma paniculatum (Bur.and Franch). documentation. Herba Polonica 51(2):38-47
1057 on LS with GA3 medium (Tables 2 and 3). However, the addition of GA3 to SH medium resulted in lower levels of ACS and IBS. In the presence of GA3, the growth rate of all root lines diminished slightly (Table 1), but shikonin derivative production was not affected (Tables 2 and 3). Different results were obtained by Yoshikawa et al. (1986) who observed that GA3 strongly inhibited shikonin formation in L. erythrorhizon callus culture but had no effect on cell growth. The line Lc1-D appeared the most suitable for ACS and IBS production on all media tested. This root line yielded ACS and IBS levels ranging from 0.712 to 2.720 mg g−1 of dry weight and from 0.0402 to 0.307 mg g−1 of dry weight, respectively. The content was not accompanied by abundant biomass increase (Table 1), which was the lowest among all investigated hairy root lines. This result was consistent with those reported by Payne et al. (1991) who found that many secondary metabolites were produced by cultures, which were either not growing at all or growing very slowly. The presence of PA was also examined in our lines. We detected traces of PA in hairy roots of L. canescens (data not shown). The most sensitive methods for detecting PA on TLC using Ehrlich reagent (4-dimethylaminobenzaldehyde; Mattocks, 1967) showed the presence of PA in each examined line of L. canescens hairy roots. This result was confirmed by gas chromatography combined with mass spectrometry (GC– MS), a valuable and highly sensitive means for the detection and identification of pyrrolizidine alkaloids. The GC–MS spectrum of investigated compounds shows the [M]+-peak at 399 indicating the molecular formula C20H33NO7. The further fragmentations are the same for 7-O-(3-hydroxy- 3-methyl-butanoyl)-9-O-( + )-trachelanthoyl-heliotridine (canescine) and 7-O-(3-hydroxy-3-methyl-butanoyl)-9-O- ( − )-viridifloryl-heliotridine (canescenine), as described earlier (Wiedenfeld et al. 2003). To summarize briefly, we can state that L. canescens is susceptible to genetic transformation with A. rhizogenes. ACS and IBS are the main compounds among the other unidentified shikonin derivatives in transformed hairy roots of L. canescens. ACS and IBS contents in hairy roots constitute ca. 10% of those observed in natural roots of L. canescens(24.35 and 14.48 mg g−1 DW, respectively). The HPLC-UV results show that shikonin itself could not be detected in the transformed hairy roots but more shikonin derivatives were found in transformed hairy roots of L. canescens than in control roots of plants growing in their natural habitat (Fig. 3). Line Lc1-D proved to be a good source of shikonin derivatives and will be used to scale up ACS and IBS production. Acknowledgements This investigation was supported by a research grant PBZ-KBN-092/P05/2003 from the State Committee of Scientific Research. We are thankful to Dr. Branka Barl, chief scientist, New Era Nutrition, Inc., Edmonton, Alberta, for plants and seeds of L. canescens. We are also grateful to Professor Mondher Jaziri from the Laboratory of Biotechnology and Plant Morphology, Free University of Brussels for the bacterial strain A. rhizogenes NCIB 8196. We thank Mr Ireneusz Rudnicki, Photodepartment of Medical University of Warsaw, Poland for photographic documentation. References Birgham LA, Michaels PJ, Flores HE (1999) Cell-specific production and antimicrobial activity of naphthoquinones in roots of Lithospermum erythrorhizon. Plant Physiol 119:417–428 Boom R, Sol C, Beld M, Weel J, Goudsmit J, Wertheim-van Dillen P (1999) Improved silica-guanidiniumthiocyanate DNA isolation procedure based on selective binding of bovine alpha-casein to silica particles. J Clin Microbiol 37:615–619. Chang HN, Sim SJ (1996) Genetic transformation of Lithospermum erythrorhizon for increased production of shikonin. In: Bajaj YPS (ed) Biotechnology in agriculture and forestry, vol 38. Plant protoplasts and genetic engineering VII. Springer-Verlag, Berlin Heldelberg, pp 233–242 Fujita Y, Hara Y, Suga C, Morimoto T (1981) Production of shikonin derivatives by cell suspension cultures of Lithospermum erythrorhizon. A new medium for the production of shikonin derivatives. Plant Cell Rep 1:61–63 Hiroshi K, Hitoshi S (1988) Production of naphthoquinone compound. JP–J63230093 Hosokawa K, Matsuki R, Oikawa Y, Yamamura S (1997) Genetic transformation of gentian using wild-type Agrobacterium rhizogenes. Plant Cell Tissue Organ Cult 51:137–140 Kropczynska D, Kawka B, Pietrosiuk A, Furmanowa M, Wiedenfeld ´ H (2004) The effect of pyrrolizidine alkaloids on the Colorado potato beetle (Leptinotarsa decemlineata Say). Acta Biol Cracoviensia Ser Zool 46:83–86 Linsmaier EM, Skoog F (1965) Organic growth factor requirement in relationship to cytokinin in “normal” and “mutant” strains of tobacco callus. Planta 72:146–154 Mattocks AR (1967) Detection of pyrrolizidine alkaloids on thin-layer chromatograms. J Chromatogr 27:505–508 Papageorgiou VP, Assimopoulou AN, Couladouros EA, Hepworth D, Nicolaou KC, (1999) The chemistry and biology of alkannin, shikonin, and related naphtazarin natural products. Angew Chem Int Ed 38:270–300 Payne GF, Bringi V, Prince C, Shuler ML (1991) Quantifying growth and product synthesis: kinetics and stoichiometry. In: Payne GF, Bringi V, Prince C, Shuler ML (eds) Plant cell and tissue culture in liquid systems. Hanser Publishers, Munich Vienna New York Barcelona, pp 48–70 Pietrosiuk A, Furmanowa M, Kropczynska D, Kawka B, Wieden- ´ feld H (2003a) Life history of the two-spotted spider mite (Tetranychus urticae Koch) feeding on bean leaves treated with pyrrolizidine alkaloids. J Appl Toxicol 23:187–190 Pietrosiuk A, K˛edzia B, Hołderna-K˛edzia E, Wiedenfeld H, Malinowski M, Furmanowa M (2003b) Antimicrobial activity of naphthoquinones from Lithospermum canescens Lehm. Herba Polonica 49(3/4):209–215 Pietrosiuk A, Skopinska-R ´ o´zewska E, Furmanowa M, Wiedenfeld ˙ H, Sommer E, Sokolnicka I, Bany J, Malinowski M (2004a) Immunomodulatory effect of shikonin derivatives isolated from Lithospermum canescens on cellular and humoral immunity in Balb/c mice. Die Pharmazie 59:640–642 Pietrosiuk A, Furmanowa M, Skopinska-R ´ o´zewska E, Sommer E, ˙ Skurzak H, Bany J (2004b) The effect of acetylshikonin isolated from Lithospermum canescens roots on tumor-induced cutaneous angiogenesis. Acta Polon Pharm Drug Res 61(5):379– 382 Pietrosiuk A, Wiedenfeld H (2005) Shikonin derivatives from Lithospermum canescens (Michx.) Lehm. Pharm Biol 43(2):189–191 Schenk RU, Hildebrandt AC (1972) Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can J Bot 50:199–204 Shimomura K, Sudo H, Saga H, Kamada H (1991) Shikonin production and secretion by hairy root cultures Lithospermum erythrorhizon. Plant Cell Rep 10:282–285 Sykłowska-Baranek K, Pietrosiuk A, Dłuska H, Furmanowa M (2004) Clonal multiplication of Lithospermum canescens (Michx.) Lehm. and Onosma paniculatum (Bur. and Franch). Herba Polonica 51(2):38–47
1058 Tabata M(1985)Production of shikonin by plant cell cultures.In:Wiedenfeld H.Pietrosiuk A.Furmanowa M,Roeder E (2003) Zaitlin M.Day P.Hollaender A (eds)Biotechnology in plant Pyrrolizidine alkaloids from Lithospermum canescens Lehm.Z science.Relevance to agriculture in the eighties.Academic Naturforsch 58c:173-176 Press,Inc.,pp 207-218 Yazaki K,Tanaka S,Matsuoka H,Sato F (1998)Stable trans- USDA.NRCS (2004)The PLANTS Database.Version 3.5 formation of Lithospermum erythrorhizon by Agrobacteriun (http://plants.usda.gov).National Plant Data Center.Baton rhizogenes and shikonin production by transformants.Plant Rouge,LA 70874-4490 USA Cell Rep 18:214-219 Vervliet G,Holsters M,Teuchy H,Van MM,Schell J (1975) Yoshikawa N,Fukui H,Tabata M (1986)Effect of gibberellin Characterization of different plaque-forming and defective A3 on shikonin production in Lithospermum callus cultures. temperate phages in Agrobacterium.J Gen Virol 26:33-48 Phytochemistry 25(3):621-622 Wiedenfeld H,Pietrosiuk A.Furmanowa M.Roeder E(1998)Pig- ments compounds in Lithospermum canescens Lehm.In 46th annual congress society for medicinal plant research-"quality of medicinal plants and herbal medicinal products,"August 31st-September 4th,1998,Vienna,Austria
1058 Tabata M (1985) Production of shikonin by plant cell cultures. In: Zaitlin M, Day P, Hollaender A (eds) Biotechnology in plant science. Relevance to agriculture in the eighties. Academic Press, Inc., pp 207–218 USDA, NRCS (2004) The PLANTS Database, Version 3.5 (http://plants.usda.gov). National Plant Data Center, Baton Rouge, LA 70874-4490 USA Vervliet G, Holsters M, Teuchy H, Van MM, Schell J (1975) Characterization of different plaque-forming and defective temperate phages in Agrobacterium. J Gen Virol 26:33–48 Wiedenfeld H, Pietrosiuk A, Furmanowa M, Roeder E (1998) Pigments compounds in Lithospermum canescens Lehm. In 46th annual congress society for medicinal plant research—“quality of medicinal plants and herbal medicinal products,” August 31st–September 4th, 1998, Vienna, Austria Wiedenfeld H, Pietrosiuk A, Furmanowa M, Roeder E (2003) Pyrrolizidine alkaloids from Lithospermum canescens Lehm. Z Naturforsch 58c:173–176 Yazaki K, Tanaka S, Matsuoka H, Sato F (1998) Stable transformation of Lithospermum erythrorhizon by Agrobacteriun rhizogenes and shikonin production by transformants. Plant Cell Rep 18:214–219 Yoshikawa N, Fukui H, Tabata M (1986) Effect of gibberellin A3 on shikonin production in Lithospermum callus cultures. Phytochemistry 25(3):621–622
